Incidental Mutation 'R2403:H2-Q4'
ID248840
Institutional Source Beutler Lab
Gene Symbol H2-Q4
Ensembl Gene ENSMUSG00000035929
Gene Namehistocompatibility 2, Q region locus 4
SynonymsH2-Gs10, Qa-4, Qb1, Qb-1, H-2Q4, Qa4, Qat-4
MMRRC Submission 040369-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2403 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location35379617-35385290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35379997 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 81 (E81G)
Ref Sequence ENSEMBL: ENSMUSP00000080159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081435]
Predicted Effect probably damaging
Transcript: ENSMUST00000081435
AA Change: E81G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000080159
Gene: ENSMUSG00000035929
AA Change: E81G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:MHC_I 50 228 1.7e-93 PFAM
IGc1 247 318 8.55e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113886
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173975
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: This locus controls an antigen on peripheral T-cells of spleen, lymph node and bone marrow, but not on thymocytes. Strain distribution patterns vary by assay, measuring presence/absence of antigen, protein acidic/basic qualities and molecular polymorphisms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,170,943 E925G probably damaging Het
Abca9 T G 11: 110,115,454 Q1275P probably benign Het
Adgrl1 T A 8: 83,931,241 M492K probably benign Het
Ankrd50 T A 3: 38,483,085 K3* probably null Het
Arl5b T C 2: 15,075,037 S140P probably damaging Het
Armc1 T C 3: 19,157,676 probably benign Het
Ascc1 T C 10: 60,004,841 I8T probably benign Het
Bche A G 3: 73,701,472 V207A probably damaging Het
Cacna2d3 A G 14: 28,905,302 L1080P probably benign Het
Ceacam3 C A 7: 17,161,854 A583D probably damaging Het
Cep290 C T 10: 100,537,437 A1193V probably benign Het
Clcn1 T C 6: 42,313,112 I827T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col28a1 T C 6: 8,175,641 D69G possibly damaging Het
Cts3 A G 13: 61,564,992 W305R probably damaging Het
Dmwd T C 7: 19,081,159 I578T possibly damaging Het
Dnmt3a G A 12: 3,899,883 V559M probably damaging Het
Dysf T C 6: 84,039,567 V70A possibly damaging Het
Eml6 A G 11: 29,802,434 V993A probably benign Het
Etl4 T A 2: 20,807,306 L1768* probably null Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fat3 T G 9: 15,969,871 D3235A probably damaging Het
Fbxo36 T A 1: 84,900,102 F162I probably damaging Het
Fgfrl1 T C 5: 108,705,031 W200R probably damaging Het
Fsip2 T C 2: 82,980,720 M2461T possibly damaging Het
Fut1 A G 7: 45,619,219 Y144C probably benign Het
Gprin3 G A 6: 59,354,149 A391V probably benign Het
Hacd3 A G 9: 65,001,029 S162P probably damaging Het
Itga1 A T 13: 114,977,614 H918Q probably benign Het
Lrp5 C A 19: 3,597,430 D1271Y probably damaging Het
Lsm8 C T 6: 18,849,644 T17I probably benign Het
Mup4 T A 4: 59,958,145 D141V probably damaging Het
Nckap5 G A 1: 126,027,409 H405Y probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr361 T C 2: 37,084,974 Y258C probably benign Het
Ostf1 T C 19: 18,584,662 K190R probably benign Het
Pnldc1 A T 17: 12,899,890 V197E probably damaging Het
Ptprc A G 1: 138,088,532 S531P probably damaging Het
Ryr3 C T 2: 112,686,628 E3318K probably damaging Het
Scamp2 T C 9: 57,577,712 V67A possibly damaging Het
Serpina3g C A 12: 104,241,162 L195M probably damaging Het
Siglec1 G T 2: 131,074,475 T1185N possibly damaging Het
Sycp2 G A 2: 178,403,735 Q31* probably null Het
Tmprss15 T G 16: 79,057,690 T277P probably damaging Het
Trim34b C T 7: 104,329,669 S41L probably benign Het
Ttn T C 2: 76,727,361 T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 V138A possibly damaging Het
Zfp523 A G 17: 28,195,209 I72M probably damaging Het
Zfp655 C T 5: 145,244,546 R405C probably benign Het
Zfp715 G A 7: 43,299,268 R423C possibly damaging Het
Other mutations in H2-Q4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:H2-Q4 APN 17 35382858 missense probably damaging 1.00
IGL01341:H2-Q4 APN 17 35383002 missense probably damaging 1.00
IGL01538:H2-Q4 APN 17 35383312 missense probably benign 0.03
IGL03258:H2-Q4 APN 17 35380119 missense probably benign 0.29
FR4304:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4340:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4342:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
FR4589:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
LCD18:H2-Q4 UTSW 17 35380405 missense probably damaging 1.00
R1655:H2-Q4 UTSW 17 35382905 missense probably damaging 1.00
R1887:H2-Q4 UTSW 17 35380137 missense possibly damaging 0.94
R2013:H2-Q4 UTSW 17 35380550 missense probably damaging 1.00
R2073:H2-Q4 UTSW 17 35380402 missense possibly damaging 0.61
R3813:H2-Q4 UTSW 17 35383095 missense possibly damaging 0.79
R3928:H2-Q4 UTSW 17 35379690 missense unknown
R5076:H2-Q4 UTSW 17 35380441 missense probably damaging 1.00
R5096:H2-Q4 UTSW 17 35379713 splice site probably benign
R5252:H2-Q4 UTSW 17 35380435 missense probably benign 0.00
R5318:H2-Q4 UTSW 17 35383311 missense possibly damaging 0.48
R5618:H2-Q4 UTSW 17 35379925 missense probably damaging 1.00
R6648:H2-Q4 UTSW 17 35383005 missense probably damaging 1.00
R7351:H2-Q4 UTSW 17 35382878 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- AACAATGCTGCTTCTGCTGG -3'
(R):5'- CTCAGAACCTCGAACTTGGG -3'

Sequencing Primer
(F):5'- AGACCCTGATCGAGATCCG -3'
(R):5'- TCGTGACCTCCGATCCG -3'
Posted On2014-11-11