Incidental Mutation 'R2403:Lrp5'
ID248842
Institutional Source Beutler Lab
Gene Symbol Lrp5
Ensembl Gene ENSMUSG00000024913
Gene Namelow density lipoprotein receptor-related protein 5
SynonymsLR3, LRP7
MMRRC Submission 040369-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.878) question?
Stock #R2403 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location3584828-3686564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3597430 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 1271 (D1271Y)
Ref Sequence ENSEMBL: ENSMUSP00000025856 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025856] [ENSMUST00000177294] [ENSMUST00000177330]
Predicted Effect probably damaging
Transcript: ENSMUST00000025856
AA Change: D1271Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025856
Gene: ENSMUSG00000024913
AA Change: D1271Y

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
LY 229 270 4e-5 SMART
EGF 297 336 1.01e-1 SMART
LY 364 406 5.15e-8 SMART
LY 407 449 4.12e-16 SMART
LY 450 493 7.68e-16 SMART
LY 494 536 6.24e-16 SMART
LY 537 577 3.73e-5 SMART
EGF 603 640 2.48e-1 SMART
LY 666 708 5.92e-8 SMART
LY 709 751 5.65e-14 SMART
LY 752 795 3.81e-11 SMART
LY 796 837 3.54e-6 SMART
LY 838 877 1.33e-1 SMART
EGF 904 941 1.22e0 SMART
LY 968 1009 4.39e-2 SMART
LY 1015 1057 1.81e0 SMART
LY 1058 1102 9.47e-7 SMART
LY 1103 1145 6.91e-9 SMART
LY 1146 1186 1.53e0 SMART
EGF 1215 1253 2.85e-1 SMART
LDLa 1257 1296 1.23e-13 SMART
LDLa 1297 1333 3.26e-9 SMART
LDLa 1334 1371 1.31e-13 SMART
transmembrane domain 1384 1406 N/A INTRINSIC
low complexity region 1494 1503 N/A INTRINSIC
low complexity region 1571 1578 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177294
SMART Domains Protein: ENSMUSP00000134771
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
LY 1 26 1.88e1 SMART
LY 27 70 3.81e-11 SMART
LY 71 112 3.54e-6 SMART
LY 113 152 1.33e-1 SMART
EGF 179 216 1.22e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177330
SMART Domains Protein: ENSMUSP00000134983
Gene: ENSMUSG00000024913

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
LY 54 96 1.26e0 SMART
LY 99 141 2.11e-13 SMART
LY 142 185 1.32e-14 SMART
LY 186 228 1.6e-13 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.9%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane low-density lipoprotein receptor that binds and internalizes ligands in the process of receptor-mediated endocytosis. This protein also acts as a co-receptor with Frizzled protein family members for transducing signals by Wnt proteins and was originally cloned on the basis of its association with type 1 diabetes mellitus in humans. This protein plays a key role in skeletal homeostasis and many bone density related diseases are caused by mutations in this gene. Mutations in this gene also cause familial exudative vitreoretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous mutants show variable bone loss, decreased osteoblast proliferation, impaired glucose tolerance, increased plasma cholesterol on high-fat diet and persistent embryonic eye vascularization, depending on allelic combination and strain background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 A G 3: 122,170,943 E925G probably damaging Het
Abca9 T G 11: 110,115,454 Q1275P probably benign Het
Adgrl1 T A 8: 83,931,241 M492K probably benign Het
Ankrd50 T A 3: 38,483,085 K3* probably null Het
Arl5b T C 2: 15,075,037 S140P probably damaging Het
Armc1 T C 3: 19,157,676 probably benign Het
Ascc1 T C 10: 60,004,841 I8T probably benign Het
Bche A G 3: 73,701,472 V207A probably damaging Het
Cacna2d3 A G 14: 28,905,302 L1080P probably benign Het
Ceacam3 C A 7: 17,161,854 A583D probably damaging Het
Cep290 C T 10: 100,537,437 A1193V probably benign Het
Clcn1 T C 6: 42,313,112 I827T probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col28a1 T C 6: 8,175,641 D69G possibly damaging Het
Cts3 A G 13: 61,564,992 W305R probably damaging Het
Dmwd T C 7: 19,081,159 I578T possibly damaging Het
Dnmt3a G A 12: 3,899,883 V559M probably damaging Het
Dysf T C 6: 84,039,567 V70A possibly damaging Het
Eml6 A G 11: 29,802,434 V993A probably benign Het
Etl4 T A 2: 20,807,306 L1768* probably null Het
F11 A G 8: 45,248,638 S353P probably damaging Het
Fat3 T G 9: 15,969,871 D3235A probably damaging Het
Fbxo36 T A 1: 84,900,102 F162I probably damaging Het
Fgfrl1 T C 5: 108,705,031 W200R probably damaging Het
Fsip2 T C 2: 82,980,720 M2461T possibly damaging Het
Fut1 A G 7: 45,619,219 Y144C probably benign Het
Gprin3 G A 6: 59,354,149 A391V probably benign Het
H2-Q4 A G 17: 35,379,997 E81G probably damaging Het
Hacd3 A G 9: 65,001,029 S162P probably damaging Het
Itga1 A T 13: 114,977,614 H918Q probably benign Het
Lsm8 C T 6: 18,849,644 T17I probably benign Het
Mup4 T A 4: 59,958,145 D141V probably damaging Het
Nckap5 G A 1: 126,027,409 H405Y probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr361 T C 2: 37,084,974 Y258C probably benign Het
Ostf1 T C 19: 18,584,662 K190R probably benign Het
Pnldc1 A T 17: 12,899,890 V197E probably damaging Het
Ptprc A G 1: 138,088,532 S531P probably damaging Het
Ryr3 C T 2: 112,686,628 E3318K probably damaging Het
Scamp2 T C 9: 57,577,712 V67A possibly damaging Het
Serpina3g C A 12: 104,241,162 L195M probably damaging Het
Siglec1 G T 2: 131,074,475 T1185N possibly damaging Het
Sycp2 G A 2: 178,403,735 Q31* probably null Het
Tmprss15 T G 16: 79,057,690 T277P probably damaging Het
Trim34b C T 7: 104,329,669 S41L probably benign Het
Ttn T C 2: 76,727,361 T21507A possibly damaging Het
Umad1 T C 6: 8,427,161 V138A possibly damaging Het
Zfp523 A G 17: 28,195,209 I72M probably damaging Het
Zfp655 C T 5: 145,244,546 R405C probably benign Het
Zfp715 G A 7: 43,299,268 R423C possibly damaging Het
Other mutations in Lrp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Lrp5 APN 19 3649404 missense probably benign
IGL00902:Lrp5 APN 19 3600774 missense probably damaging 1.00
IGL02032:Lrp5 APN 19 3615886 splice site probably benign
IGL02331:Lrp5 APN 19 3591816 missense possibly damaging 0.64
IGL02401:Lrp5 APN 19 3593585 missense probably damaging 1.00
IGL02471:Lrp5 APN 19 3602408 missense probably benign 0.31
IGL02572:Lrp5 APN 19 3614283 missense probably benign 0.17
IGL02637:Lrp5 APN 19 3630269 missense probably benign 0.03
IGL02696:Lrp5 APN 19 3602253 missense probably benign
IGL02742:Lrp5 APN 19 3604022 missense probably damaging 0.99
IGL02804:Lrp5 APN 19 3600777 missense possibly damaging 0.63
IGL03089:Lrp5 APN 19 3620314 splice site probably null
IGL03243:Lrp5 APN 19 3630159 missense probably benign 0.12
Contrarian UTSW 19 3659355 missense probably damaging 1.00
contrarian2 UTSW 19 3652296 missense probably damaging 1.00
lucent UTSW 19 3686353 critical splice donor site probably null
Microtome UTSW 19 3622638 missense probably damaging 1.00
r18 UTSW 19 small insertion
R6791_Lrp5_616 UTSW 19 3600753 missense probably damaging 1.00
Spicule UTSW 19 3612197 critical splice donor site probably null
PIT4494001:Lrp5 UTSW 19 3610091 missense probably damaging 1.00
R0219:Lrp5 UTSW 19 3597349 missense probably damaging 1.00
R0526:Lrp5 UTSW 19 3628295 missense probably damaging 1.00
R0597:Lrp5 UTSW 19 3600777 missense possibly damaging 0.63
R0883:Lrp5 UTSW 19 3605308 missense probably damaging 1.00
R1086:Lrp5 UTSW 19 3649476 missense probably benign 0.28
R1417:Lrp5 UTSW 19 3586425 missense probably benign 0.04
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1468:Lrp5 UTSW 19 3620191 missense possibly damaging 0.76
R1533:Lrp5 UTSW 19 3614234 missense probably benign 0.17
R1538:Lrp5 UTSW 19 3647585 missense possibly damaging 0.70
R1856:Lrp5 UTSW 19 3597346 missense probably benign 0.18
R1930:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1931:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1932:Lrp5 UTSW 19 3610131 missense probably benign 0.02
R1951:Lrp5 UTSW 19 3620298 missense possibly damaging 0.89
R2016:Lrp5 UTSW 19 3610056 missense probably benign 0.04
R2131:Lrp5 UTSW 19 3622708 missense possibly damaging 0.87
R2153:Lrp5 UTSW 19 3614339 missense probably benign 0.22
R3158:Lrp5 UTSW 19 3615849 missense probably damaging 0.97
R3771:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3772:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3773:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3825:Lrp5 UTSW 19 3605290 nonsense probably null
R3887:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3888:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3893:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R3917:Lrp5 UTSW 19 3612330 missense probably damaging 1.00
R4279:Lrp5 UTSW 19 3591778 missense possibly damaging 0.94
R4714:Lrp5 UTSW 19 3659454 missense probably damaging 1.00
R4825:Lrp5 UTSW 19 3614292 missense probably damaging 1.00
R5102:Lrp5 UTSW 19 3659304 missense probably damaging 0.96
R5138:Lrp5 UTSW 19 3628319 missense probably benign 0.03
R5497:Lrp5 UTSW 19 3602319 missense probably damaging 1.00
R5632:Lrp5 UTSW 19 3622512 missense probably benign
R5887:Lrp5 UTSW 19 3604094 missense probably benign 0.01
R5950:Lrp5 UTSW 19 3602333 missense probably benign 0.17
R5987:Lrp5 UTSW 19 3628299 missense probably damaging 1.00
R6080:Lrp5 UTSW 19 3628316 missense probably benign 0.32
R6181:Lrp5 UTSW 19 3628427 missense probably damaging 1.00
R6236:Lrp5 UTSW 19 3630483 splice site probably null
R6332:Lrp5 UTSW 19 3659355 missense probably damaging 1.00
R6511:Lrp5 UTSW 19 3652296 missense probably damaging 1.00
R6641:Lrp5 UTSW 19 3652287 missense probably damaging 1.00
R6791:Lrp5 UTSW 19 3600753 missense probably damaging 1.00
R6865:Lrp5 UTSW 19 3620013 critical splice donor site probably null
R6906:Lrp5 UTSW 19 3622638 missense probably damaging 1.00
R6922:Lrp5 UTSW 19 3605301 missense probably damaging 1.00
R7091:Lrp5 UTSW 19 3630184 missense probably damaging 1.00
R7303:Lrp5 UTSW 19 3591774 missense probably damaging 0.99
R7368:Lrp5 UTSW 19 3620085 missense possibly damaging 0.95
R7381:Lrp5 UTSW 19 3593588 missense probably benign 0.20
R7385:Lrp5 UTSW 19 3612197 critical splice donor site probably null
R7392:Lrp5 UTSW 19 3610199 missense probably damaging 1.00
R7448:Lrp5 UTSW 19 3649439 missense probably benign 0.01
R7585:Lrp5 UTSW 19 3604094 missense possibly damaging 0.88
R7662:Lrp5 UTSW 19 3686353 critical splice donor site probably null
R7984:Lrp5 UTSW 19 3612342 missense probably damaging 1.00
R8056:Lrp5 UTSW 19 3597337 missense probably damaging 0.98
R8391:Lrp5 UTSW 19 3604185 missense probably damaging 1.00
Z1177:Lrp5 UTSW 19 3628345 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTTTAATGGGACCTGGGAG -3'
(R):5'- TCACATGAGCAGGAGACAGTC -3'

Sequencing Primer
(F):5'- GCAGTTAGCTTCATCAGAGCGATC -3'
(R):5'- AGACAGTCCCCAGGGCAC -3'
Posted On2014-11-11