Incidental Mutation 'R2404:Satb2'
ID248844
Institutional Source Beutler Lab
Gene Symbol Satb2
Ensembl Gene ENSMUSG00000038331
Gene Namespecial AT-rich sequence binding protein 2
Synonyms
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location56793981-56978650 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56948108 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 106 (Y106C)
Ref Sequence ENSEMBL: ENSMUSP00000110057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042857] [ENSMUST00000114415] [ENSMUST00000176759] [ENSMUST00000177424]
Predicted Effect probably benign
Transcript: ENSMUST00000042857
SMART Domains Protein: ENSMUSP00000046067
Gene: ENSMUSG00000038331

DomainStartEndE-ValueType
PDB:3TUO|D 45 98 8e-19 PDB
PDB:3NZL|A 106 174 4e-35 PDB
low complexity region 235 251 N/A INTRINSIC
CUT 292 378 1.3e-36 SMART
low complexity region 381 399 N/A INTRINSIC
CUT 415 501 3.58e-39 SMART
low complexity region 510 524 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
HOX 555 618 1.06e-7 SMART
low complexity region 629 650 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114415
AA Change: Y106C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110057
Gene: ENSMUSG00000038331
AA Change: Y106C

DomainStartEndE-ValueType
Pfam:ULD 58 156 1.7e-39 PFAM
Pfam:CUTL 162 233 3.9e-46 PFAM
low complexity region 294 310 N/A INTRINSIC
CUT 351 437 1.3e-36 SMART
low complexity region 440 458 N/A INTRINSIC
CUT 474 560 3.58e-39 SMART
low complexity region 569 583 N/A INTRINSIC
low complexity region 592 610 N/A INTRINSIC
HOX 614 677 1.06e-7 SMART
low complexity region 688 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176759
SMART Domains Protein: ENSMUSP00000135163
Gene: ENSMUSG00000038331

DomainStartEndE-ValueType
PDB:3TUO|D 63 104 1e-15 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000177424
AA Change: Y106C

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135391
Gene: ENSMUSG00000038331
AA Change: Y106C

DomainStartEndE-ValueType
PDB:3TUO|D 57 115 6e-23 PDB
low complexity region 176 192 N/A INTRINSIC
CUT 233 319 1.3e-36 SMART
low complexity region 322 340 N/A INTRINSIC
CUT 356 442 3.58e-39 SMART
low complexity region 451 465 N/A INTRINSIC
low complexity region 474 492 N/A INTRINSIC
HOX 496 559 1.06e-7 SMART
low complexity region 570 591 N/A INTRINSIC
Meta Mutation Damage Score 0.7651 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA binding protein that specifically binds nuclear matrix attachment regions. The encoded protein is involved in transcription regulation and chromatin remodeling. Defects in this gene are associated with isolated cleft palate and mental retardation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous inactivation of this gene causes complete perinatal lethality and craniofacial anomalies, such as cleft palate, micrognathia, microcephaly, decreased tongue size, absent incisors and nasal capsule hypoplasia, and leads to short limbs and defects in osteoblast differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Satb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Satb2 APN 1 56831541 missense possibly damaging 0.56
IGL02008:Satb2 APN 1 56796793 missense possibly damaging 0.70
IGL02209:Satb2 APN 1 56871518 missense probably damaging 1.00
IGL02956:Satb2 APN 1 56948175 missense probably damaging 0.99
IGL03214:Satb2 APN 1 56845580 missense probably damaging 1.00
IGL03272:Satb2 APN 1 56845643 missense probably damaging 1.00
IGL03356:Satb2 APN 1 56891174 missense probably damaging 1.00
R0990:Satb2 UTSW 1 56850184 missense probably damaging 0.96
R1534:Satb2 UTSW 1 56948233 nonsense probably null
R1711:Satb2 UTSW 1 56850289 missense probably damaging 0.99
R1952:Satb2 UTSW 1 56899070 missense probably damaging 1.00
R3792:Satb2 UTSW 1 56845620 missense probably damaging 1.00
R3870:Satb2 UTSW 1 56891220 missense probably damaging 1.00
R3871:Satb2 UTSW 1 56891220 missense probably damaging 1.00
R4333:Satb2 UTSW 1 56845586 missense probably damaging 1.00
R4621:Satb2 UTSW 1 56845619 missense probably damaging 1.00
R4962:Satb2 UTSW 1 56891168 missense probably benign 0.25
R5296:Satb2 UTSW 1 56796907 missense probably damaging 0.99
R5314:Satb2 UTSW 1 56831527 missense probably damaging 0.99
R5407:Satb2 UTSW 1 56948150 missense probably damaging 1.00
R5925:Satb2 UTSW 1 56796938 missense possibly damaging 0.80
R6355:Satb2 UTSW 1 56948197 missense probably damaging 1.00
R6634:Satb2 UTSW 1 56845721 nonsense probably null
R6645:Satb2 UTSW 1 56797007 missense possibly damaging 0.51
R7578:Satb2 UTSW 1 56871784 missense probably benign 0.01
R7694:Satb2 UTSW 1 56871524 missense probably benign
R7811:Satb2 UTSW 1 56845721 missense probably benign 0.19
R8009:Satb2 UTSW 1 56871758 missense probably benign 0.01
R8023:Satb2 UTSW 1 56891231 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACCAATTTGCTGACTTAGTGC -3'
(R):5'- TGTAACACCCCGTTCTGCTG -3'

Sequencing Primer
(F):5'- GTGGCACTGGACAAATACTTC -3'
(R):5'- CTGTCTGATTGTGTCCTCCTAGG -3'
Posted On2014-11-11