Incidental Mutation 'R2404:Slc19a3'
ID248845
Institutional Source Beutler Lab
Gene Symbol Slc19a3
Ensembl Gene ENSMUSG00000038496
Gene Namesolute carrier family 19, member 3
SynonymsThTr2, A230084E24Rik
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location83012523-83038448 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83023035 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 87 (H87L)
Ref Sequence ENSEMBL: ENSMUSP00000126646 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045560] [ENSMUST00000164473]
Predicted Effect probably benign
Transcript: ENSMUST00000045560
AA Change: H87L

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000041683
Gene: ENSMUSG00000038496
AA Change: H87L

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.4e-178 PFAM
Pfam:MFS_1 16 416 1.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142805
Predicted Effect probably benign
Transcript: ENSMUST00000164473
AA Change: H87L

PolyPhen 2 Score 0.158 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000126646
Gene: ENSMUSG00000038496
AA Change: H87L

DomainStartEndE-ValueType
Pfam:Folate_carrier 11 435 1.3e-178 PFAM
Pfam:MFS_1 16 416 1.9e-17 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitously expressed transmembrane thiamine transporter that lacks folate transport activity. Mutations in this gene cause biotin-responsive basal ganglia disease (BBGD); a recessive disorder manifested in childhood that progresses to chronic encephalopathy, dystonia, quadriparesis, and death if untreated. Patients with BBGD have bilateral necrosis in the head of the caudate nucleus and in the putamen. Administration of high doses of biotin in the early progression of the disorder eliminates pathological symptoms while delayed treatment results in residual paraparesis, mild mental retardation, or dystonia. Administration of thiamine is ineffective in the treatment of this disorder. Experiments have failed to show that this protein can transport biotin. Mutations in this gene also cause a Wernicke's-like encephalopathy.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death within a year of age, impaired thiamin uptake, lethargy, cachexia, injured liver parenchyma, hepatic necrosis, liver and kidney inflammmation, and nephrosclerosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Slc19a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03066:Slc19a3 APN 1 83014836 missense probably damaging 0.99
R0437:Slc19a3 UTSW 1 83022565 missense probably benign 0.00
R0526:Slc19a3 UTSW 1 83022733 missense probably damaging 1.00
R1160:Slc19a3 UTSW 1 83022692 missense possibly damaging 0.85
R1306:Slc19a3 UTSW 1 83022762 missense probably damaging 1.00
R1832:Slc19a3 UTSW 1 83022747 missense probably damaging 0.99
R1938:Slc19a3 UTSW 1 83019368 missense possibly damaging 0.76
R1961:Slc19a3 UTSW 1 83022798 missense probably benign 0.00
R2058:Slc19a3 UTSW 1 83014791 missense probably damaging 0.98
R2200:Slc19a3 UTSW 1 83022943 missense probably damaging 0.96
R2245:Slc19a3 UTSW 1 83013970 missense possibly damaging 0.84
R2261:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3891:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3892:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3907:Slc19a3 UTSW 1 83014813 missense possibly damaging 0.76
R3912:Slc19a3 UTSW 1 83022703 missense probably benign 0.09
R3922:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3923:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R3961:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4083:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4106:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4107:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4109:Slc19a3 UTSW 1 83022957 missense probably damaging 1.00
R4667:Slc19a3 UTSW 1 83022799 missense probably benign
R4768:Slc19a3 UTSW 1 83023113 missense probably damaging 1.00
R4769:Slc19a3 UTSW 1 83019341 missense probably damaging 1.00
R5001:Slc19a3 UTSW 1 83022620 missense probably benign 0.33
R5538:Slc19a3 UTSW 1 83022561 missense possibly damaging 0.51
R5588:Slc19a3 UTSW 1 83023055 nonsense probably null
R6143:Slc19a3 UTSW 1 83026339 missense probably benign 0.00
R6546:Slc19a3 UTSW 1 83026360 missense probably benign 0.02
R6547:Slc19a3 UTSW 1 83022900 missense probably damaging 1.00
R7059:Slc19a3 UTSW 1 83022369 missense probably damaging 1.00
R7497:Slc19a3 UTSW 1 83013928 missense probably damaging 1.00
R7509:Slc19a3 UTSW 1 83026260 missense probably damaging 1.00
R7584:Slc19a3 UTSW 1 83022748 missense possibly damaging 0.79
R7810:Slc19a3 UTSW 1 83019441 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCGACAGTAGCTGCTCACTTTC -3'
(R):5'- TCCCCAACAACTCCTTGGTG -3'

Sequencing Primer
(F):5'- GACAGTAGCTGCTCACTTTCTGATAG -3'
(R):5'- AACAACTCCTTGGTGGCTTATTTTTG -3'
Posted On2014-11-11