Incidental Mutation 'R2404:Egfl7'
ID248846
Institutional Source Beutler Lab
Gene Symbol Egfl7
Ensembl Gene ENSMUSG00000026921
Gene NameEGF-like domain 7
SynonymsZneu1, vascular endothelial-statin, VE-statin
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.402) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location26580014-26593120 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 26589150 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 25 (E25K)
Ref Sequence ENSEMBL: ENSMUSP00000097863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028286] [ENSMUST00000100290] [ENSMUST00000102907] [ENSMUST00000139801] [ENSMUST00000145575] [ENSMUST00000149789] [ENSMUST00000150404] [ENSMUST00000152713] [ENSMUST00000152988] [ENSMUST00000166920] [ENSMUST00000173920] [ENSMUST00000174066] [ENSMUST00000174211]
Predicted Effect probably benign
Transcript: ENSMUST00000028286
SMART Domains Protein: ENSMUSP00000028286
Gene: ENSMUSG00000026922

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 28 50 N/A INTRINSIC
PlsC 92 207 5.17e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083606
Predicted Effect possibly damaging
Transcript: ENSMUST00000100290
AA Change: E25K

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097863
Gene: ENSMUSG00000026921
AA Change: E25K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.5e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102907
AA Change: E25K

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099971
Gene: ENSMUSG00000026921
AA Change: E25K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 32 98 5.6e-21 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131940
Predicted Effect possibly damaging
Transcript: ENSMUST00000139801
AA Change: E25K

PolyPhen 2 Score 0.864 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123465
Gene: ENSMUSG00000026921
AA Change: E25K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 6.9e-20 PFAM
low complexity region 101 125 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000145575
AA Change: E25K

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000118924
Gene: ENSMUSG00000026921
AA Change: E25K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 8e-20 PFAM
EGF 110 139 2.6e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147351
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149460
Predicted Effect probably benign
Transcript: ENSMUST00000149789
Predicted Effect possibly damaging
Transcript: ENSMUST00000150404
AA Change: E25K

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115482
Gene: ENSMUSG00000026921
AA Change: E25K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000152713
AA Change: E25K

PolyPhen 2 Score 0.454 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000152988
Predicted Effect possibly damaging
Transcript: ENSMUST00000166920
AA Change: E25K

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000128741
Gene: ENSMUSG00000026921
AA Change: E25K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172683
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173777
Predicted Effect probably benign
Transcript: ENSMUST00000173920
AA Change: E25K

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000134503
Gene: ENSMUSG00000026921
AA Change: E25K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 3e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000174066
AA Change: E25K
SMART Domains Protein: ENSMUSP00000133799
Gene: ENSMUSG00000092356
AA Change: E25K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 64 88 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174211
AA Change: E25K

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134034
Gene: ENSMUSG00000026921
AA Change: E25K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EMI 31 100 2.7e-19 PFAM
EGF 110 139 2.6e-4 SMART
EGF_like 144 181 4.2e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174572
Predicted Effect probably benign
Transcript: ENSMUST00000174656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199077
Meta Mutation Damage Score 0.1017 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted endothelial cell protein that contains two epidermal growth factor-like domains. The encoded protein may play a role in regulating vasculogenesis. This protein may be involved in the growth and proliferation of tumor cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality with absent heartbeat and systemic edema, delayed vasculogenesis, decreased angiogenesis, abnormal adult vasculature, and low-level hypoxia. Mice homozygous for a null allele that does not disrupt Mirn126 expression are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Egfl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03279:Egfl7 APN 2 26590707 missense probably benign 0.08
PIT4362001:Egfl7 UTSW 2 26591040 missense probably benign
R0607:Egfl7 UTSW 2 26589440 missense probably damaging 1.00
R0678:Egfl7 UTSW 2 26590940 missense probably benign 0.02
R4921:Egfl7 UTSW 2 26590980 missense probably benign 0.05
R5572:Egfl7 UTSW 2 26591691 missense possibly damaging 0.92
R7332:Egfl7 UTSW 2 26590713 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGAGCTGTCACTGCCTTTG -3'
(R):5'- AATGGGGTCAGCTAGTGGTC -3'

Sequencing Primer
(F):5'- GAGCTGTCACTGCCTTTGAATGC -3'
(R):5'- TCAGCTAGTGGTCTAGAGCCAG -3'
Posted On2014-11-11