Incidental Mutation 'R2404:Olfr1121'
ID248847
Institutional Source Beutler Lab
Gene Symbol Olfr1121
Ensembl Gene ENSMUSG00000070852
Gene Nameolfactory receptor 1121
SynonymsMOR264-18, GA_x6K02T2Q125-48863863-48864807
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87369895-87373469 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87372224 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 231 (I231V)
Ref Sequence ENSEMBL: ENSMUSP00000150120 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062555] [ENSMUST00000213792]
Predicted Effect probably benign
Transcript: ENSMUST00000062555
AA Change: I231V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000058201
Gene: ENSMUSG00000070852
AA Change: I231V

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.3e-54 PFAM
Pfam:7tm_1 47 296 3.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213792
AA Change: I231V

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.3599 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Olfr1121
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02534:Olfr1121 APN 2 87372254 missense probably benign
IGL03280:Olfr1121 APN 2 87372123 missense probably damaging 1.00
R0501:Olfr1121 UTSW 2 87371552 missense probably damaging 0.96
R1350:Olfr1121 UTSW 2 87372357 missense probably benign
R1713:Olfr1121 UTSW 2 87371946 missense probably damaging 1.00
R4737:Olfr1121 UTSW 2 87372321 missense probably damaging 0.99
R4825:Olfr1121 UTSW 2 87372088 nonsense probably null
R5109:Olfr1121 UTSW 2 87371534 start codon destroyed probably null 0.04
R5200:Olfr1121 UTSW 2 87372102 missense probably damaging 0.99
R6393:Olfr1121 UTSW 2 87371565 missense probably damaging 1.00
R6658:Olfr1121 UTSW 2 87372153 missense probably benign 0.01
R7011:Olfr1121 UTSW 2 87372260 missense possibly damaging 0.74
R7427:Olfr1121 UTSW 2 87371690 missense probably benign 0.01
R7428:Olfr1121 UTSW 2 87371690 missense probably benign 0.01
R7671:Olfr1121 UTSW 2 87372269 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTTCAGGTTGGGCAAAC -3'
(R):5'- ATATCATGGGATTGAACACGGG -3'

Sequencing Primer
(F):5'- GGGCAAACCTGTCAAATATTCTCTC -3'
(R):5'- TTGAACACGGGGGTGATGATG -3'
Posted On2014-11-11