Incidental Mutation 'R2404:Ect2'
ID248850
Institutional Source Beutler Lab
Gene Symbol Ect2
Ensembl Gene ENSMUSG00000027699
Gene Nameect2 oncogene
Synonyms
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location27097222-27153878 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 27131850 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 495 (P495S)
Ref Sequence ENSEMBL: ENSMUSP00000103935 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108298] [ENSMUST00000108300] [ENSMUST00000176242] [ENSMUST00000184113]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108296
Predicted Effect probably benign
Transcript: ENSMUST00000108298
AA Change: P464S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103933
Gene: ENSMUSG00000027699
AA Change: P464S

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108300
AA Change: P495S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000103935
Gene: ENSMUSG00000027699
AA Change: P495S

DomainStartEndE-ValueType
BRCT 174 250 1.45e-10 SMART
BRCT 268 344 2.52e-10 SMART
low complexity region 362 372 N/A INTRINSIC
RhoGEF 456 640 3.22e-67 SMART
Blast:PH 667 794 1e-80 BLAST
low complexity region 856 870 N/A INTRINSIC
low complexity region 887 896 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124727
Predicted Effect probably benign
Transcript: ENSMUST00000176242
AA Change: P464S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135740
Gene: ENSMUSG00000027699
AA Change: P464S

DomainStartEndE-ValueType
BRCT 143 219 1.45e-10 SMART
BRCT 237 313 2.52e-10 SMART
low complexity region 331 341 N/A INTRINSIC
RhoGEF 425 609 3.22e-67 SMART
Blast:PH 636 763 9e-81 BLAST
low complexity region 825 839 N/A INTRINSIC
low complexity region 856 865 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184113
Meta Mutation Damage Score 0.0634 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor and transforming protein that is related to Rho-specific exchange factors and yeast cell cycle regulators. The expression of this gene is elevated with the onset of DNA synthesis and remains elevated during G2 and M phases. In situ hybridization analysis showed that expression is at a high level in cells undergoing mitosis in regenerating liver. Thus, this protein is expressed in a cell cycle-dependent manner during liver regeneration, and is thought to have an important role in the regulation of cytokinesis. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2017]
PHENOTYPE: Homozygous disruption of this locus is embryonic lethal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Ect2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00671:Ect2 APN 3 27138669 missense probably benign 0.04
IGL00770:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL00774:Ect2 APN 3 27098443 missense probably damaging 0.99
IGL01414:Ect2 APN 3 27127729 splice site probably benign
IGL02017:Ect2 APN 3 27122044 nonsense probably null
IGL02318:Ect2 APN 3 27138719 missense probably benign 0.16
IGL02395:Ect2 APN 3 27150106 missense probably damaging 1.00
IGL03109:Ect2 APN 3 27144972 missense possibly damaging 0.88
IGL03178:Ect2 APN 3 27148860 missense probably benign 0.03
IGL03055:Ect2 UTSW 3 27137062 missense probably damaging 1.00
PIT4504001:Ect2 UTSW 3 27126948 nonsense probably null
R0090:Ect2 UTSW 3 27115476 missense probably benign 0.00
R0090:Ect2 UTSW 3 27138502 missense probably null 0.08
R0436:Ect2 UTSW 3 27150095 missense probably benign 0.11
R0620:Ect2 UTSW 3 27139652 missense probably damaging 0.99
R1847:Ect2 UTSW 3 27150072 missense probably benign 0.01
R3890:Ect2 UTSW 3 27138540 missense probably damaging 1.00
R3951:Ect2 UTSW 3 27130120 missense probably benign 0.00
R4588:Ect2 UTSW 3 27147000 missense probably damaging 1.00
R4754:Ect2 UTSW 3 27126963 missense probably damaging 1.00
R5051:Ect2 UTSW 3 27102486 missense probably benign
R5254:Ect2 UTSW 3 27130070 missense probably damaging 1.00
R5415:Ect2 UTSW 3 27146853 missense probably damaging 1.00
R5786:Ect2 UTSW 3 27146953 missense probably damaging 1.00
R5940:Ect2 UTSW 3 27115465 missense probably benign 0.01
R5974:Ect2 UTSW 3 27144963 nonsense probably null
R6012:Ect2 UTSW 3 27098325 utr 3 prime probably benign
R6434:Ect2 UTSW 3 27139119 nonsense probably null
R6447:Ect2 UTSW 3 27115484 missense probably damaging 1.00
R6850:Ect2 UTSW 3 27138885 missense probably damaging 1.00
R6989:Ect2 UTSW 3 27102488 nonsense probably null
R7147:Ect2 UTSW 3 27150090 missense probably benign 0.12
R7257:Ect2 UTSW 3 27138535 missense probably damaging 1.00
R7417:Ect2 UTSW 3 27098419 missense probably damaging 1.00
R7564:Ect2 UTSW 3 27116123 intron probably benign
R7662:Ect2 UTSW 3 27131798 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCTAGAGTAGTGTCTTAAAGCC -3'
(R):5'- AGGGAGCACACTTTCCTTGG -3'

Sequencing Primer
(F):5'- GCCAGAAACATTGTGAGATCTAC -3'
(R):5'- GGCTCTTTCTAGGGTTGCCATC -3'
Posted On2014-11-11