Incidental Mutation 'R2404:Zc3h12a'
ID248854
Institutional Source Beutler Lab
Gene Symbol Zc3h12a
Ensembl Gene ENSMUSG00000042677
Gene Namezinc finger CCCH type containing 12A
SynonymsMcpip1
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.699) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location125118423-125127840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 125119523 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 516 (Y516C)
Ref Sequence ENSEMBL: ENSMUSP00000037172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036188]
Predicted Effect probably damaging
Transcript: ENSMUST00000036188
AA Change: Y516C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037172
Gene: ENSMUSG00000042677
AA Change: Y516C

DomainStartEndE-ValueType
Pfam:RNase_Zc3h12a 134 290 3.2e-66 PFAM
low complexity region 354 368 N/A INTRINSIC
low complexity region 476 487 N/A INTRINSIC
low complexity region 494 508 N/A INTRINSIC
low complexity region 514 544 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131685
Meta Mutation Damage Score 0.0804 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZC3H12A is an MCP1 (CCL2; MIM 158105)-induced protein that acts as a transcriptional activator and causes cell death of cardiomyocytes, possibly via induction of genes associated with apoptosis.[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit splenomegaly, lymphadenopathy, hyperimmunoglobulinemia, increased auto-antibodies, and defective IL6 post-transcriptional regulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Zc3h12a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01928:Zc3h12a APN 4 125119986 missense probably benign 0.00
IGL02419:Zc3h12a APN 4 125119788 missense probably benign
IGL03085:Zc3h12a APN 4 125127020 missense probably benign 0.19
IGL03181:Zc3h12a APN 4 125119304 missense probably damaging 1.00
I1329:Zc3h12a UTSW 4 125119364 missense possibly damaging 0.85
P0022:Zc3h12a UTSW 4 125119409 missense possibly damaging 0.69
R2084:Zc3h12a UTSW 4 125120009 missense probably benign 0.00
R2149:Zc3h12a UTSW 4 125126642 missense possibly damaging 0.77
R3862:Zc3h12a UTSW 4 125126939 missense probably benign
R3891:Zc3h12a UTSW 4 125126885 missense probably damaging 1.00
R4707:Zc3h12a UTSW 4 125120893 missense probably damaging 1.00
R5215:Zc3h12a UTSW 4 125126913 missense probably benign 0.17
R5283:Zc3h12a UTSW 4 125126765 missense probably benign 0.11
R5570:Zc3h12a UTSW 4 125120373 missense probably damaging 1.00
X0026:Zc3h12a UTSW 4 125126871 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGGAAGCGTCTCATTAC -3'
(R):5'- AGCCAGATGTCAGAATTATGGG -3'

Sequencing Primer
(F):5'- GGGAAGCGTCTCATTACAGCTTC -3'
(R):5'- CAGATGTCAGAATTATGGGGCGTG -3'
Posted On2014-11-11