Mutagenetix > Incidental Mutation

Incidental Mutation 'R2404:Chd5'

248856

Institutional Source

Beutler Lab

Gene Symbol

Chd5

Ensembl Gene

ENSMUSG00000005045

Gene Name

chromodomain helicase DNA binding protein 5

Synonyms

B230399N07Rik, 4930532L22Rik

MMRRC Submission

040370-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2404 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

152423108-152474651 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 152451791 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 701 (T701M)

Ref Sequence

ENSEMBL: ENSMUSP00000005175 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005175] [ENSMUST00000030775] [ENSMUST00000164662]

AlphaFold

A2A8L1

Predicted Effect

probably damaging
Transcript: ENSMUST00000005175
AA Change: T701M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000005175
Gene: ENSMUSG00000005045
AA Change: T701M

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
Pfam:CHDNT	149	203	2e-32	PFAM
low complexity region	209	220	N/A	INTRINSIC
low complexity region	256	273	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
PHD	347	390	1.09e-14	SMART
RING	348	389	4.48e-1	SMART
low complexity region	400	416	N/A	INTRINSIC
PHD	420	463	3.29e-14	SMART
RING	421	462	4.15e0	SMART
CHROMO	468	548	2.52e-13	SMART
CHROMO	592	649	1.34e-8	SMART
low complexity region	657	678	N/A	INTRINSIC
DEXDc	698	910	8.34e-33	SMART
low complexity region	1023	1038	N/A	INTRINSIC
HELICc	1056	1140	4.02e-26	SMART
DUF1087	1297	1361	2.78e-33	SMART
DUF1086	1374	1533	5.11e-105	SMART
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1685	1701	N/A	INTRINSIC
Pfam:CHDCT2	1729	1901	1.7e-99	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000030775
AA Change: T701M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000030775
Gene: ENSMUSG00000005045
AA Change: T701M

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
Pfam:CHDNT	150	203	9e-28	PFAM
low complexity region	209	220	N/A	INTRINSIC
low complexity region	256	273	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
PHD	347	390	1.09e-14	SMART
RING	348	389	4.48e-1	SMART
low complexity region	400	416	N/A	INTRINSIC
PHD	420	463	3.29e-14	SMART
RING	421	462	4.15e0	SMART
CHROMO	468	548	2.52e-13	SMART
CHROMO	592	649	1.34e-8	SMART
low complexity region	657	678	N/A	INTRINSIC
DEXDc	698	910	8.34e-33	SMART
low complexity region	1023	1038	N/A	INTRINSIC
HELICc	1056	1140	4.02e-26	SMART
DUF1087	1297	1361	2.78e-33	SMART
DUF1086	1374	1533	5.11e-105	SMART
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1685	1701	N/A	INTRINSIC
Pfam:CHDCT2	1730	1901	2.8e-93	PFAM
low complexity region	1922	1936	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124423

Predicted Effect

probably damaging
Transcript: ENSMUST00000164662
AA Change: T701M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132600
Gene: ENSMUSG00000005045
AA Change: T701M

Domain	Start	End	E-Value	Type
low complexity region	17	40	N/A	INTRINSIC
low complexity region	46	71	N/A	INTRINSIC
low complexity region	76	92	N/A	INTRINSIC
coiled coil region	96	126	N/A	INTRINSIC
Pfam:CHDNT	149	203	1.9e-32	PFAM
low complexity region	209	220	N/A	INTRINSIC
low complexity region	256	273	N/A	INTRINSIC
low complexity region	291	304	N/A	INTRINSIC
low complexity region	323	333	N/A	INTRINSIC
PHD	347	390	1.09e-14	SMART
RING	348	389	4.48e-1	SMART
low complexity region	400	416	N/A	INTRINSIC
PHD	420	463	3.29e-14	SMART
RING	421	462	4.15e0	SMART
CHROMO	468	548	2.52e-13	SMART
CHROMO	592	649	1.34e-8	SMART
low complexity region	657	678	N/A	INTRINSIC
DEXDc	698	910	8.34e-33	SMART
low complexity region	1023	1038	N/A	INTRINSIC
HELICc	1056	1140	4.02e-26	SMART
DUF1087	1260	1324	2.78e-33	SMART
DUF1086	1337	1496	5.11e-105	SMART
low complexity region	1515	1530	N/A	INTRINSIC
low complexity region	1648	1664	N/A	INTRINSIC
Pfam:CHDCT2	1692	1864	1.7e-99	PFAM
low complexity region	1885	1899	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.2%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the chromodomain helicase DNA-binding protein family. Members of this family are characterized by a chromodomain, a helicase ATP-binding domain and an additional functional domain. This gene encodes a neuron-specific protein that may function in chromatin remodeling and gene transcription. This gene is a potential tumor suppressor gene that may play a role in the development of neuroblastoma. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with abnormal spermiogenesis and chromatin condensation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933402N03Rik	T	C	7: 130,740,923 (GRCm39)	T98A	possibly damaging	Het
Aifm2	A	G	10: 61,563,974 (GRCm39)	I161V	probably benign	Het
Arhgef26	T	C	3: 62,336,336 (GRCm39)	M625T	possibly damaging	Het
Atp9a	T	A	2: 168,517,283 (GRCm39)		probably null	Het
Avpr1a	T	C	10: 122,285,115 (GRCm39)	F136L	possibly damaging	Het
Bcas3	T	C	11: 85,245,715 (GRCm39)		probably benign	Het
Bnc1	A	T	7: 81,618,463 (GRCm39)	H867Q	probably benign	Het
Cdh12	C	T	15: 21,537,720 (GRCm39)	T407I	probably damaging	Het
Dhx57	A	G	17: 80,561,733 (GRCm39)	V927A	probably damaging	Het
Dnah2	A	G	11: 69,328,047 (GRCm39)	F3353L	probably damaging	Het
Ect2	G	A	3: 27,185,999 (GRCm39)	P495S	probably benign	Het
Egfl7	G	A	2: 26,479,162 (GRCm39)	E25K	possibly damaging	Het
Gm5117	T	C	8: 32,227,306 (GRCm39)		noncoding transcript	Het
Hbs1l	A	T	10: 21,171,946 (GRCm39)		probably benign	Het
Insrr	C	T	3: 87,709,974 (GRCm39)	T309I	possibly damaging	Het
Kalrn	C	T	16: 33,810,180 (GRCm39)	D2525N	possibly damaging	Het
Kif12	A	C	4: 63,088,790 (GRCm39)	L170R	probably damaging	Het
Krt90	A	G	15: 101,463,105 (GRCm39)		probably null	Het
Mcu	A	G	10: 59,303,526 (GRCm39)	S104P	probably damaging	Het
Mical3	G	A	6: 120,936,789 (GRCm39)	P374S	probably benign	Het
Ncam2	A	T	16: 81,287,128 (GRCm39)		probably benign	Het
Or12e9	A	G	2: 87,202,568 (GRCm39)	I231V	probably benign	Het
Or2t47	A	T	11: 58,442,546 (GRCm39)	I173N	probably damaging	Het
Or2w1b	T	C	13: 21,300,012 (GRCm39)	L50P	probably damaging	Het
Or5k17	G	A	16: 58,745,998 (GRCm39)	S312L	probably benign	Het
Otud7a	A	G	7: 63,346,899 (GRCm39)	S158G	probably benign	Het
Phlpp1	C	T	1: 106,100,569 (GRCm39)	T279M	probably benign	Het
Pkhd1l1	T	G	15: 44,414,216 (GRCm39)	W2828G	probably damaging	Het
Pnma8a	A	T	7: 16,694,316 (GRCm39)	N57I	probably damaging	Het
Ppp4r4	A	G	12: 103,547,749 (GRCm39)		probably null	Het
Ptprq	T	C	10: 107,522,460 (GRCm39)	Y531C	probably damaging	Het
Rai1	A	G	11: 60,080,750 (GRCm39)	T1605A	probably benign	Het
Satb2	T	C	1: 56,987,267 (GRCm39)	Y106C	probably damaging	Het
Sgms1	G	A	19: 32,137,072 (GRCm39)	R165*	probably null	Het
Slc19a3	T	A	1: 83,000,756 (GRCm39)	H87L	probably benign	Het
Slc4a7	G	T	14: 14,733,733 (GRCm38)	V54L	probably damaging	Het
Sp110	A	C	1: 85,505,050 (GRCm39)	F434C	probably benign	Het
Spen	T	C	4: 141,205,216 (GRCm39)	N1137S	unknown	Het
Spice1	T	C	16: 44,186,989 (GRCm39)	I162T	probably benign	Het
Spmip1	G	A	6: 29,473,390 (GRCm39)	R173Q	probably benign	Het
Sqor	A	T	2: 122,649,943 (GRCm39)	T396S	probably benign	Het
Tshz3	A	T	7: 36,469,805 (GRCm39)	Q598L	probably damaging	Het
Ttc13	C	T	8: 125,405,736 (GRCm39)		probably benign	Het
Ubxn2a	T	C	12: 4,933,851 (GRCm39)	T187A	probably benign	Het
Usp28	T	C	9: 48,948,558 (GRCm39)		probably null	Het
Zc3h12a	T	C	4: 125,013,316 (GRCm39)	Y516C	probably damaging	Het
Zfp616	A	C	11: 73,975,682 (GRCm39)	K650N	probably damaging	Het

Other mutations in Chd5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Chd5	APN	4	152,445,059 (GRCm39)	missense	probably damaging	1.00
IGL00886:Chd5	APN	4	152,444,156 (GRCm39)	missense	probably benign	0.00
IGL00963:Chd5	APN	4	152,467,395 (GRCm39)	missense	probably damaging	1.00
IGL01399:Chd5	APN	4	152,441,144 (GRCm39)	missense	probably damaging	1.00
IGL01571:Chd5	APN	4	152,468,572 (GRCm39)	splice site	probably benign
IGL01606:Chd5	APN	4	152,445,432 (GRCm39)	missense	probably damaging	0.99
IGL01636:Chd5	APN	4	152,469,110 (GRCm39)	nonsense	probably null
IGL02009:Chd5	APN	4	152,450,670 (GRCm39)	missense	probably damaging	1.00
IGL02417:Chd5	APN	4	152,451,751 (GRCm39)	missense	probably damaging	0.97
IGL02504:Chd5	APN	4	152,447,779 (GRCm39)	missense	probably damaging	0.99
IGL02508:Chd5	APN	4	152,447,481 (GRCm39)	missense	probably damaging	1.00
IGL02597:Chd5	APN	4	152,456,169 (GRCm39)	missense	probably damaging	1.00
IGL02608:Chd5	APN	4	152,440,564 (GRCm39)	missense	possibly damaging	0.94
IGL02612:Chd5	APN	4	152,445,033 (GRCm39)	missense	probably damaging	1.00
IGL02658:Chd5	APN	4	152,445,050 (GRCm39)	missense	probably damaging	1.00
IGL02662:Chd5	APN	4	152,456,588 (GRCm39)	missense	probably damaging	1.00
IGL02676:Chd5	APN	4	152,440,530 (GRCm39)	splice site	probably benign
IGL02871:Chd5	APN	4	152,461,142 (GRCm39)	missense	probably damaging	1.00
IGL02942:Chd5	APN	4	152,470,182 (GRCm39)	missense	probably damaging	0.98
IGL02956:Chd5	APN	4	152,464,413 (GRCm39)	missense	probably benign	0.00
IGL03286:Chd5	APN	4	152,469,952 (GRCm39)	missense	probably benign	0.00
IGL03348:Chd5	APN	4	152,461,142 (GRCm39)	missense	probably damaging	1.00
IGL03398:Chd5	APN	4	152,461,539 (GRCm39)	missense	probably damaging	0.97
PIT1430001:Chd5	UTSW	4	152,455,094 (GRCm39)	missense	probably damaging	1.00
PIT4151001:Chd5	UTSW	4	152,462,986 (GRCm39)	missense	probably damaging	0.99
R0079:Chd5	UTSW	4	152,470,206 (GRCm39)	missense	probably damaging	1.00
R0241:Chd5	UTSW	4	152,450,589 (GRCm39)	missense	probably damaging	1.00
R0241:Chd5	UTSW	4	152,450,589 (GRCm39)	missense	probably damaging	1.00
R0379:Chd5	UTSW	4	152,467,778 (GRCm39)	missense	probably benign	0.00
R0388:Chd5	UTSW	4	152,456,101 (GRCm39)	missense	probably damaging	1.00
R0675:Chd5	UTSW	4	152,470,407 (GRCm39)	missense	probably benign	0.06
R0730:Chd5	UTSW	4	152,432,441 (GRCm39)	missense	possibly damaging	0.72
R0799:Chd5	UTSW	4	152,468,616 (GRCm39)	missense	probably damaging	1.00
R0800:Chd5	UTSW	4	152,440,614 (GRCm39)	missense	probably damaging	1.00
R1276:Chd5	UTSW	4	152,463,191 (GRCm39)	missense	probably damaging	1.00
R1752:Chd5	UTSW	4	152,459,590 (GRCm39)	missense	probably damaging	1.00
R1753:Chd5	UTSW	4	152,463,272 (GRCm39)	missense	probably damaging	1.00
R1843:Chd5	UTSW	4	152,470,263 (GRCm39)	missense	probably damaging	1.00
R1850:Chd5	UTSW	4	152,454,990 (GRCm39)	missense	probably damaging	1.00
R1851:Chd5	UTSW	4	152,462,727 (GRCm39)	missense	probably damaging	0.97
R1859:Chd5	UTSW	4	152,464,980 (GRCm39)	missense	probably benign	0.00
R1983:Chd5	UTSW	4	152,469,123 (GRCm39)	missense	possibly damaging	0.89
R2897:Chd5	UTSW	4	152,456,572 (GRCm39)	missense	probably damaging	1.00
R2898:Chd5	UTSW	4	152,456,572 (GRCm39)	missense	probably damaging	1.00
R3893:Chd5	UTSW	4	152,445,113 (GRCm39)	missense	probably damaging	1.00
R3938:Chd5	UTSW	4	152,461,512 (GRCm39)	missense	probably benign	0.05
R4707:Chd5	UTSW	4	152,445,039 (GRCm39)	missense	probably damaging	1.00
R4754:Chd5	UTSW	4	152,462,203 (GRCm39)	missense	probably damaging	0.99
R4911:Chd5	UTSW	4	152,445,129 (GRCm39)	missense	probably damaging	1.00
R4924:Chd5	UTSW	4	152,450,886 (GRCm39)	missense	possibly damaging	0.50
R4926:Chd5	UTSW	4	152,467,768 (GRCm39)	missense	probably benign	0.00
R5256:Chd5	UTSW	4	152,456,554 (GRCm39)	missense	probably benign	0.01
R5524:Chd5	UTSW	4	152,461,087 (GRCm39)	missense	probably benign
R5552:Chd5	UTSW	4	152,470,272 (GRCm39)	missense	possibly damaging	0.95
R5895:Chd5	UTSW	4	152,464,389 (GRCm39)	missense	probably benign	0.13
R5945:Chd5	UTSW	4	152,464,408 (GRCm39)	missense	probably benign
R6007:Chd5	UTSW	4	152,463,878 (GRCm39)	missense	probably null	1.00
R6039:Chd5	UTSW	4	152,438,078 (GRCm39)	small deletion	probably benign
R6039:Chd5	UTSW	4	152,438,078 (GRCm39)	small deletion	probably benign
R6172:Chd5	UTSW	4	152,463,848 (GRCm39)	missense	probably damaging	1.00
R6173:Chd5	UTSW	4	152,463,848 (GRCm39)	missense	probably damaging	1.00
R6323:Chd5	UTSW	4	152,451,791 (GRCm39)	missense	probably damaging	0.99
R6331:Chd5	UTSW	4	152,466,865 (GRCm39)	missense	probably benign	0.02
R6495:Chd5	UTSW	4	152,451,829 (GRCm39)	missense	probably damaging	1.00
R6528:Chd5	UTSW	4	152,441,133 (GRCm39)	missense	probably damaging	1.00
R6849:Chd5	UTSW	4	152,462,995 (GRCm39)	missense	probably damaging	1.00
R6854:Chd5	UTSW	4	152,467,395 (GRCm39)	missense	probably damaging	1.00
R6859:Chd5	UTSW	4	152,462,664 (GRCm39)	missense	probably damaging	1.00
R6999:Chd5	UTSW	4	152,458,891 (GRCm39)	missense	probably damaging	1.00
R7034:Chd5	UTSW	4	152,445,398 (GRCm39)	missense	possibly damaging	0.89
R7110:Chd5	UTSW	4	152,469,896 (GRCm39)	missense	probably damaging	1.00
R7361:Chd5	UTSW	4	152,447,745 (GRCm39)	missense	probably damaging	0.99
R7397:Chd5	UTSW	4	152,452,469 (GRCm39)	missense	possibly damaging	0.82
R7440:Chd5	UTSW	4	152,469,108 (GRCm39)	missense	probably benign	0.01
R7489:Chd5	UTSW	4	152,457,925 (GRCm39)	missense	probably damaging	1.00
R7810:Chd5	UTSW	4	152,443,032 (GRCm39)	missense	probably damaging	0.97
R8057:Chd5	UTSW	4	152,450,829 (GRCm39)	missense	probably damaging	1.00
R8078:Chd5	UTSW	4	152,445,448 (GRCm39)	missense	possibly damaging	0.90
R8092:Chd5	UTSW	4	152,463,261 (GRCm39)	missense	probably damaging	0.99
R8170:Chd5	UTSW	4	152,461,040 (GRCm39)	missense	probably benign	0.26
R8255:Chd5	UTSW	4	152,463,880 (GRCm39)	missense	probably damaging	0.99
R8348:Chd5	UTSW	4	152,445,173 (GRCm39)	missense	probably damaging	0.98
R8448:Chd5	UTSW	4	152,445,173 (GRCm39)	missense	probably damaging	0.98
R8478:Chd5	UTSW	4	152,441,147 (GRCm39)	nonsense	probably null
R8482:Chd5	UTSW	4	152,441,147 (GRCm39)	nonsense	probably null
R8670:Chd5	UTSW	4	152,469,953 (GRCm39)	missense	possibly damaging	0.81
R8733:Chd5	UTSW	4	152,463,923 (GRCm39)	missense	probably damaging	1.00
R8743:Chd5	UTSW	4	152,450,862 (GRCm39)	missense	probably benign	0.03
R8941:Chd5	UTSW	4	152,463,305 (GRCm39)	missense	possibly damaging	0.82
R8961:Chd5	UTSW	4	152,467,489 (GRCm39)	splice site	probably benign
R9103:Chd5	UTSW	4	152,461,444 (GRCm39)	missense	possibly damaging	0.62
R9160:Chd5	UTSW	4	152,469,916 (GRCm39)	missense	probably damaging	0.99
R9221:Chd5	UTSW	4	152,456,122 (GRCm39)	missense	probably damaging	0.96
R9399:Chd5	UTSW	4	152,468,592 (GRCm39)	missense	probably benign	0.06
R9429:Chd5	UTSW	4	152,447,364 (GRCm39)	missense	probably damaging	0.99
R9635:Chd5	UTSW	4	152,461,079 (GRCm39)	missense	possibly damaging	0.87
R9783:Chd5	UTSW	4	152,458,865 (GRCm39)	missense	probably damaging	1.00
Z1176:Chd5	UTSW	4	152,462,936 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CTTGGAGAGACATTCTGGGG -3'
(R):5'- AACCTGAGGTGGTGAAGCTG -3'

Sequencing Primer
(F):5'- ACATTCTGGGGGACACCTTGAG -3'
(R):5'- AGACCTCGCCTGCTCAGAC -3'

Posted On

2014-11-11