Incidental Mutation 'R2404:Pnmal1'
ID248859
Institutional Source Beutler Lab
Gene Symbol Pnmal1
Ensembl Gene ENSMUSG00000041141
Gene NamePNMA-like 1
Synonyms
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.081) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16959679-16964607 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16960391 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 57 (N57I)
Ref Sequence ENSEMBL: ENSMUSP00000040929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038163]
Predicted Effect probably damaging
Transcript: ENSMUST00000038163
AA Change: N57I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040929
Gene: ENSMUSG00000041141
AA Change: N57I

DomainStartEndE-ValueType
Pfam:PNMA 5 364 6.9e-108 PFAM
Meta Mutation Damage Score 0.8489 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Pnmal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4737:Pnmal1 UTSW 7 16961425 small insertion probably benign
R0116:Pnmal1 UTSW 7 16960700 missense probably damaging 0.97
R0140:Pnmal1 UTSW 7 16960222 start codon destroyed probably null 0.00
R1109:Pnmal1 UTSW 7 16961467 nonsense probably null
R1306:Pnmal1 UTSW 7 16962025 missense probably benign 0.00
R1426:Pnmal1 UTSW 7 16960984 missense possibly damaging 0.56
R2000:Pnmal1 UTSW 7 16961039 missense probably benign 0.01
R3415:Pnmal1 UTSW 7 16960954 missense possibly damaging 0.74
R3708:Pnmal1 UTSW 7 16960225 missense probably damaging 1.00
R4009:Pnmal1 UTSW 7 16961376 missense probably damaging 1.00
R4105:Pnmal1 UTSW 7 16961179 missense possibly damaging 0.81
R5126:Pnmal1 UTSW 7 16961317 missense probably benign 0.03
R5244:Pnmal1 UTSW 7 16961323 missense probably damaging 0.99
R5825:Pnmal1 UTSW 7 16961095 missense probably benign 0.01
R5931:Pnmal1 UTSW 7 16960884 missense probably benign 0.31
R6128:Pnmal1 UTSW 7 16960736 missense probably benign 0.00
R7337:Pnmal1 UTSW 7 16961390 missense probably benign 0.35
R7756:Pnmal1 UTSW 7 16961299 missense probably benign 0.27
R7758:Pnmal1 UTSW 7 16961299 missense probably benign 0.27
RF007:Pnmal1 UTSW 7 16961424 small insertion probably benign
RF009:Pnmal1 UTSW 7 16961427 small insertion probably benign
RF020:Pnmal1 UTSW 7 16961451 small insertion probably benign
RF022:Pnmal1 UTSW 7 16961427 small insertion probably benign
RF029:Pnmal1 UTSW 7 16961444 nonsense probably null
RF039:Pnmal1 UTSW 7 16961444 small insertion probably benign
RF041:Pnmal1 UTSW 7 16961444 nonsense probably null
RF046:Pnmal1 UTSW 7 16961423 small insertion probably benign
RF047:Pnmal1 UTSW 7 16961423 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TTTCACGAACAGGTAGAGCAG -3'
(R):5'- TCAAGAGGCGCACCATATCC -3'

Sequencing Primer
(F):5'- CAGAAAGATGTCGGAGCCC -3'
(R):5'- TTCGCCATCCAAGAATTCGTTCAG -3'
Posted On2014-11-11