Incidental Mutation 'R2404:Tshz3'
ID248860
Institutional Source Beutler Lab
Gene Symbol Tshz3
Ensembl Gene ENSMUSG00000021217
Gene Nameteashirt zinc finger family member 3
SynonymsTsh3, teashirt3, A630038G13Rik, Zfp537
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location36698118-36773553 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36770380 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 598 (Q598L)
Ref Sequence ENSEMBL: ENSMUSP00000021641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021641]
Predicted Effect probably damaging
Transcript: ENSMUST00000021641
AA Change: Q598L

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021641
Gene: ENSMUSG00000021217
AA Change: Q598L

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 123 138 N/A INTRINSIC
low complexity region 142 164 N/A INTRINSIC
ZnF_C2H2 214 238 1.86e0 SMART
ZnF_C2H2 275 299 3.83e-2 SMART
low complexity region 313 334 N/A INTRINSIC
ZnF_C2H2 386 410 5.62e0 SMART
low complexity region 483 497 N/A INTRINSIC
coiled coil region 609 630 N/A INTRINSIC
low complexity region 796 832 N/A INTRINSIC
low complexity region 855 872 N/A INTRINSIC
HOX 890 964 2.55e-4 SMART
ZnF_C2H2 976 998 8.09e0 SMART
ZnF_C2H2 1041 1064 2.4e-3 SMART
Meta Mutation Damage Score 0.0715 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-finger transcription factor that regulates smooth muscle cell differentiation in the developing urinary tract. Consistent with this role, mice in which this gene has been inactivated exhibit abnormal gene expression in urinary tract smooth muscle cell precursors and kidney defects including hydronephrosis. The encoded transcription factor comprises a gene silencing complex that inhibits caspase expression. Reduced expression of this gene and consequent caspase upregulation may be correlated with progression of Alzheimer's disease in human patients. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit neoatal lethality likely due to respiratory distress and hydroureter and hydronephrosis associated with impaired development of ureteric smooth muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Tshz3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01875:Tshz3 APN 7 36769960 missense probably damaging 0.97
IGL01922:Tshz3 APN 7 36769605 missense probably damaging 1.00
IGL02047:Tshz3 APN 7 36770468 missense probably damaging 1.00
IGL02166:Tshz3 APN 7 36768921 missense probably benign 0.00
IGL02405:Tshz3 APN 7 36769650 missense possibly damaging 0.93
IGL02658:Tshz3 APN 7 36769158 missense probably damaging 0.99
IGL02968:Tshz3 APN 7 36769824 missense probably damaging 1.00
IGL03073:Tshz3 APN 7 36770745 missense probably damaging 1.00
IGL03233:Tshz3 APN 7 36770079 missense probably damaging 0.97
IGL03296:Tshz3 APN 7 36771336 missense probably damaging 1.00
R0049:Tshz3 UTSW 7 36770109 missense probably damaging 1.00
R0049:Tshz3 UTSW 7 36770109 missense probably damaging 1.00
R0090:Tshz3 UTSW 7 36768892 missense probably benign
R0329:Tshz3 UTSW 7 36770033 missense probably benign
R0330:Tshz3 UTSW 7 36770033 missense probably benign
R0360:Tshz3 UTSW 7 36770533 missense probably benign
R0364:Tshz3 UTSW 7 36770533 missense probably benign
R0380:Tshz3 UTSW 7 36771300 missense probably damaging 1.00
R0547:Tshz3 UTSW 7 36771417 missense probably damaging 1.00
R1061:Tshz3 UTSW 7 36768706 missense probably damaging 1.00
R1618:Tshz3 UTSW 7 36771796 missense probably damaging 1.00
R1704:Tshz3 UTSW 7 36771360 missense possibly damaging 0.92
R1881:Tshz3 UTSW 7 36771654 missense possibly damaging 0.87
R1926:Tshz3 UTSW 7 36769375 missense probably damaging 1.00
R1994:Tshz3 UTSW 7 36769822 missense probably damaging 0.99
R2447:Tshz3 UTSW 7 36768753 missense probably benign 0.00
R2930:Tshz3 UTSW 7 36771592 missense possibly damaging 0.74
R3879:Tshz3 UTSW 7 36771537 nonsense probably null
R4033:Tshz3 UTSW 7 36770584 missense possibly damaging 0.71
R4212:Tshz3 UTSW 7 36770119 missense probably damaging 1.00
R4394:Tshz3 UTSW 7 36769605 missense probably damaging 1.00
R4779:Tshz3 UTSW 7 36768972 missense probably damaging 1.00
R4977:Tshz3 UTSW 7 36771190 missense probably benign 0.31
R5139:Tshz3 UTSW 7 36771025 missense probably benign 0.23
R5448:Tshz3 UTSW 7 36771229 missense possibly damaging 0.90
R5516:Tshz3 UTSW 7 36770350 missense probably benign 0.03
R5760:Tshz3 UTSW 7 36771569 missense probably damaging 1.00
R6360:Tshz3 UTSW 7 36769441 missense probably damaging 1.00
R6481:Tshz3 UTSW 7 36752339 intron probably null
R6535:Tshz3 UTSW 7 36768789 missense probably damaging 1.00
R7105:Tshz3 UTSW 7 36769756 missense probably damaging 1.00
R7133:Tshz3 UTSW 7 36770569 missense probably benign 0.12
R7225:Tshz3 UTSW 7 36769657 missense probably damaging 1.00
R7238:Tshz3 UTSW 7 36770097 missense probably damaging 1.00
R7851:Tshz3 UTSW 7 36771589 missense probably damaging 1.00
R7934:Tshz3 UTSW 7 36771589 missense probably damaging 1.00
X0067:Tshz3 UTSW 7 36768796 missense probably benign 0.19
X0067:Tshz3 UTSW 7 36769321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGGCTCAGAATGGCACTC -3'
(R):5'- TCCTGACTTTTGAAGCTGCC -3'

Sequencing Primer
(F):5'- TGATGAAGTTGTCCCTGG -3'
(R):5'- GACTTTTGAAGCTGCCGTCGC -3'
Posted On2014-11-11