Incidental Mutation 'R2404:Ppp4r4'
ID248878
Institutional Source Beutler Lab
Gene Symbol Ppp4r4
Ensembl Gene ENSMUSG00000021209
Gene Nameprotein phosphatase 4, regulatory subunit 4
Synonyms8430415E04Rik
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location103532283-103613831 bp(+) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) A to G at 103581490 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021631] [ENSMUST00000187155] [ENSMUST00000187155] [ENSMUST00000189871] [ENSMUST00000190664] [ENSMUST00000190664]
Predicted Effect probably null
Transcript: ENSMUST00000021631
SMART Domains Protein: ENSMUSP00000021631
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
SCOP:d1gw5a_ 55 577 6e-27 SMART
PDB:3FGA|A 178 666 8e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187155
SMART Domains Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
Pfam:HEAT 145 175 2.8e-3 PFAM
low complexity region 484 495 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187155
SMART Domains Protein: ENSMUSP00000140874
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
Pfam:HEAT 145 175 2.8e-3 PFAM
low complexity region 484 495 N/A INTRINSIC
coiled coil region 581 617 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189871
SMART Domains Protein: ENSMUSP00000139786
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
SCOP:d1gw5a_ 95 577 7e-26 SMART
PDB:1B3U|B 178 666 2e-6 PDB
coiled coil region 690 726 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190664
SMART Domains Protein: ENSMUSP00000140295
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
Pfam:HEAT 38 68 5.8e-4 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000190664
SMART Domains Protein: ENSMUSP00000140295
Gene: ENSMUSG00000021209

DomainStartEndE-ValueType
Pfam:HEAT 38 68 5.8e-4 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a HEAT-like repeat-containing protein. The HEAT repeat is a tandemly repeated, 37-47 amino acid long module occurring in a number of cytoplasmic proteins. Arrays of HEAT repeats form a rod-like helical structure and appear to function as protein-protein interaction surfaces. The repeat-containing region of this protein has some similarity to the constant regulatory domain of the protein phosphatase 2A PR65/A subunit. The encoded protein binds protein serine/threonine phosphatase 4c in the cytoplasm. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Ppp4r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00827:Ppp4r4 APN 12 103579076 missense probably benign
IGL01388:Ppp4r4 APN 12 103576849 missense probably damaging 1.00
IGL01662:Ppp4r4 APN 12 103602966 missense possibly damaging 0.55
IGL01768:Ppp4r4 APN 12 103581405 missense probably benign 0.12
IGL01894:Ppp4r4 APN 12 103593138 missense probably damaging 1.00
IGL01921:Ppp4r4 APN 12 103576310 start codon destroyed probably null 0.01
IGL01960:Ppp4r4 APN 12 103581494 splice site probably benign
IGL02084:Ppp4r4 APN 12 103600398 missense possibly damaging 0.93
IGL02287:Ppp4r4 APN 12 103587488 missense probably benign 0.01
IGL02315:Ppp4r4 APN 12 103600361 splice site probably benign
IGL03137:Ppp4r4 APN 12 103581384 missense probably damaging 1.00
IGL03170:Ppp4r4 APN 12 103590774 intron probably benign
cataract UTSW 12 103612815 nonsense probably null
downfall UTSW 12 103593098 missense probably benign 0.00
R0114:Ppp4r4 UTSW 12 103576374 missense probably benign 0.00
R0390:Ppp4r4 UTSW 12 103601360 splice site probably benign
R0403:Ppp4r4 UTSW 12 103584102 missense probably benign
R0548:Ppp4r4 UTSW 12 103612815 nonsense probably null
R0601:Ppp4r4 UTSW 12 103600520 splice site probably benign
R0894:Ppp4r4 UTSW 12 103600495 missense probably damaging 0.99
R1127:Ppp4r4 UTSW 12 103579068 missense probably damaging 1.00
R1177:Ppp4r4 UTSW 12 103576323 missense possibly damaging 0.82
R1378:Ppp4r4 UTSW 12 103581492 splice site probably benign
R1442:Ppp4r4 UTSW 12 103598245 missense probably damaging 0.97
R1497:Ppp4r4 UTSW 12 103606945 missense probably benign 0.07
R1651:Ppp4r4 UTSW 12 103584072 missense probably benign 0.01
R1797:Ppp4r4 UTSW 12 103598151 missense possibly damaging 0.95
R1880:Ppp4r4 UTSW 12 103605035 missense possibly damaging 0.62
R2008:Ppp4r4 UTSW 12 103585757 missense probably damaging 1.00
R2038:Ppp4r4 UTSW 12 103576280 critical splice acceptor site probably null
R2696:Ppp4r4 UTSW 12 103581394 missense possibly damaging 0.77
R2849:Ppp4r4 UTSW 12 103606933 missense probably benign 0.00
R2965:Ppp4r4 UTSW 12 103612821 missense probably damaging 1.00
R3030:Ppp4r4 UTSW 12 103606956 missense probably benign
R3805:Ppp4r4 UTSW 12 103600366 missense probably damaging 0.99
R3862:Ppp4r4 UTSW 12 103596421 nonsense probably null
R4194:Ppp4r4 UTSW 12 103558445 missense probably damaging 1.00
R4320:Ppp4r4 UTSW 12 103598243 missense probably damaging 1.00
R4558:Ppp4r4 UTSW 12 103606933 missense probably benign 0.00
R4783:Ppp4r4 UTSW 12 103590858 critical splice donor site probably null
R4866:Ppp4r4 UTSW 12 103600447 missense possibly damaging 0.92
R4903:Ppp4r4 UTSW 12 103590771 splice site probably null
R5309:Ppp4r4 UTSW 12 103606888 splice site probably null
R5312:Ppp4r4 UTSW 12 103606888 splice site probably null
R5381:Ppp4r4 UTSW 12 103593098 missense probably benign 0.00
R5383:Ppp4r4 UTSW 12 103584168 missense probably benign 0.14
R5447:Ppp4r4 UTSW 12 103584151 missense possibly damaging 0.67
R5942:Ppp4r4 UTSW 12 103587447 missense possibly damaging 0.92
R6339:Ppp4r4 UTSW 12 103604969 nonsense probably null
R6386:Ppp4r4 UTSW 12 103593105 missense probably damaging 1.00
R6712:Ppp4r4 UTSW 12 103596443 missense probably damaging 1.00
R6755:Ppp4r4 UTSW 12 103585737 missense probably damaging 1.00
R6868:Ppp4r4 UTSW 12 103590852 missense probably damaging 1.00
R6879:Ppp4r4 UTSW 12 103551920 intron probably null
R7355:Ppp4r4 UTSW 12 103604582 nonsense probably null
R7397:Ppp4r4 UTSW 12 103612806 critical splice acceptor site probably null
R7447:Ppp4r4 UTSW 12 103585726 missense possibly damaging 0.46
R7576:Ppp4r4 UTSW 12 103596449 missense probably damaging 0.97
R7653:Ppp4r4 UTSW 12 103584145 missense probably damaging 0.98
R7683:Ppp4r4 UTSW 12 103587105 nonsense probably null
R7748:Ppp4r4 UTSW 12 103605061 critical splice donor site probably null
R7831:Ppp4r4 UTSW 12 103590821 missense possibly damaging 0.76
R7833:Ppp4r4 UTSW 12 103598148 missense probably benign 0.03
R7914:Ppp4r4 UTSW 12 103590821 missense possibly damaging 0.76
R7916:Ppp4r4 UTSW 12 103598148 missense probably benign 0.03
X0025:Ppp4r4 UTSW 12 103600480 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAAGATGTTCTCTCACATAAGTAG -3'
(R):5'- CTGAATATCCCCTGCCATGC -3'

Sequencing Primer
(F):5'- GTCTAAAATGTCCAACCATTTACATG -3'
(R):5'- GAATATCCCCTGCCATGCTTGATC -3'
Posted On2014-11-11