Incidental Mutation 'R2404:Olfr181'
ID248887
Institutional Source Beutler Lab
Gene Symbol Olfr181
Ensembl Gene ENSMUSG00000090951
Gene Nameolfactory receptor 181
SynonymsMOR184-4, GA_x54KRFPKG5P-55145984-55145034
MMRRC Submission 040370-MU
Accession Numbers

Genbank: NM_146999

Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location58924707-58928755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 58925635 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 312 (S312L)
Ref Sequence ENSEMBL: ENSMUSP00000145877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075361] [ENSMUST00000205668] [ENSMUST00000205742] [ENSMUST00000205986] [ENSMUST00000206168]
Predicted Effect probably benign
Transcript: ENSMUST00000075361
AA Change: S312L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000074825
Gene: ENSMUSG00000090951
AA Change: S312L

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 5.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 308 6.1e-6 PFAM
Pfam:7tm_1 41 308 3.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205668
Predicted Effect probably benign
Transcript: ENSMUST00000205742
AA Change: S312L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000205986
AA Change: S312L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000206168
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214942
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1) 

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Sgms1 G A 19: 32,159,672 R165* probably null Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Olfr181
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01845:Olfr181 APN 16 58926566 missense probably benign
IGL02477:Olfr181 APN 16 58925763 missense probably benign 0.07
IGL02545:Olfr181 APN 16 58926470 missense possibly damaging 0.88
IGL02690:Olfr181 APN 16 58925851 missense possibly damaging 0.78
IGL02718:Olfr181 APN 16 58926096 missense possibly damaging 0.57
IGL02945:Olfr181 APN 16 58926340 missense probably damaging 1.00
IGL03349:Olfr181 APN 16 58925960 missense probably benign 0.00
B5639:Olfr181 UTSW 16 58926526 missense probably benign 0.00
R0550:Olfr181 UTSW 16 58926385 missense probably damaging 1.00
R0659:Olfr181 UTSW 16 58926409 missense possibly damaging 0.94
R1433:Olfr181 UTSW 16 58925686 missense probably benign
R1957:Olfr181 UTSW 16 58926167 missense probably benign
R2155:Olfr181 UTSW 16 58926123 missense probably benign 0.01
R2568:Olfr181 UTSW 16 58925923 missense probably benign 0.27
R4022:Olfr181 UTSW 16 58926120 missense possibly damaging 0.94
R4592:Olfr181 UTSW 16 58926092 missense probably benign 0.00
R4673:Olfr181 UTSW 16 58925690 missense possibly damaging 0.61
R4880:Olfr181 UTSW 16 58926100 missense probably damaging 0.98
R5109:Olfr181 UTSW 16 58926059 missense probably benign 0.10
R5231:Olfr181 UTSW 16 58925714 missense possibly damaging 0.94
R5291:Olfr181 UTSW 16 58926401 missense possibly damaging 0.96
R5477:Olfr181 UTSW 16 58926030 missense possibly damaging 0.61
R5524:Olfr181 UTSW 16 58925809 missense probably benign 0.00
R5809:Olfr181 UTSW 16 58926497 missense probably benign
R5830:Olfr181 UTSW 16 58926094 missense possibly damaging 0.64
R6119:Olfr181 UTSW 16 58926532 missense possibly damaging 0.94
R6217:Olfr181 UTSW 16 58926514 missense probably benign 0.03
R6861:Olfr181 UTSW 16 58926504 missense probably benign
R6939:Olfr181 UTSW 16 58926285 nonsense probably null
R7376:Olfr181 UTSW 16 58925758 missense possibly damaging 0.82
R7650:Olfr181 UTSW 16 58926053 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCAAACAGTTGATGCCTGGC -3'
(R):5'- GTCTTCTCATGTATATTGGACCATC -3'

Sequencing Primer
(F):5'- AACAGTTGATGCCTGGCAATTTTAGG -3'
(R):5'- CCCTTTTATTTACAGCCTGAG -3'
Posted On2014-11-11