Incidental Mutation 'R2404:Sgms1'
ID248891
Institutional Source Beutler Lab
Gene Symbol Sgms1
Ensembl Gene ENSMUSG00000040451
Gene Namesphingomyelin synthase 1
SynonymsTmem23, SMS1gamma, SMS1alpha2, SMS1, SMS1beta, SMS1alpha1, 9530058O11Rik
MMRRC Submission 040370-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R2404 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location32122727-32389714 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 32159672 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 165 (R165*)
Ref Sequence ENSEMBL: ENSMUSP00000119869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099514] [ENSMUST00000134415] [ENSMUST00000142618] [ENSMUST00000151289] [ENSMUST00000151822] [ENSMUST00000152340]
Predicted Effect probably null
Transcript: ENSMUST00000099514
AA Change: R165*
SMART Domains Protein: ENSMUSP00000097114
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.3e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Pfam:PAP2 216 362 4.5e-10 PFAM
Pfam:PAP2_C 282 355 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131768
Predicted Effect probably null
Transcript: ENSMUST00000134415
AA Change: R165*
SMART Domains Protein: ENSMUSP00000115785
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 4.3e-7 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141655
Predicted Effect probably null
Transcript: ENSMUST00000142618
AA Change: R165*
SMART Domains Protein: ENSMUSP00000117336
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.3e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
Pfam:PAP2 216 362 4.5e-10 PFAM
Pfam:PAP2_C 282 355 4.9e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149107
Predicted Effect probably null
Transcript: ENSMUST00000151289
AA Change: R165*
SMART Domains Protein: ENSMUSP00000123395
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 1.5e-6 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 186 208 N/A INTRINSIC
transmembrane domain 221 243 N/A INTRINSIC
Pfam:PAP2_C 282 355 1.7e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151822
Predicted Effect probably null
Transcript: ENSMUST00000152340
AA Change: R165*
SMART Domains Protein: ENSMUSP00000119869
Gene: ENSMUSG00000040451
AA Change: R165*

DomainStartEndE-ValueType
Pfam:SAM_1 11 74 4.7e-7 PFAM
transmembrane domain 141 163 N/A INTRINSIC
transmembrane domain 188 210 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.2%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a five-pass transmembrane protein. This gene may be predominately expressed in brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, impaired insulin tolerance, increased insulin sensitivity, decreased insulin secretion, and abnormal pancreatic islet cell mitochondria morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933402N03Rik T C 7: 131,139,194 T98A possibly damaging Het
Aifm2 A G 10: 61,728,195 I161V probably benign Het
Arhgef26 T C 3: 62,428,915 M625T possibly damaging Het
Atp9a T A 2: 168,675,363 probably null Het
Avpr1a T C 10: 122,449,210 F136L possibly damaging Het
Bcas3 T C 11: 85,354,889 probably benign Het
Bnc1 A T 7: 81,968,715 H867Q probably benign Het
Cdh12 C T 15: 21,537,634 T407I probably damaging Het
Chd5 C T 4: 152,367,334 T701M probably damaging Het
Dhx57 A G 17: 80,254,304 V927A probably damaging Het
Dnah2 A G 11: 69,437,221 F3353L probably damaging Het
Ect2 G A 3: 27,131,850 P495S probably benign Het
Egfl7 G A 2: 26,589,150 E25K possibly damaging Het
Gm5117 T C 8: 31,737,278 noncoding transcript Het
Gm9047 G A 6: 29,473,391 R173Q probably benign Het
Hbs1l A T 10: 21,296,047 probably benign Het
Insrr C T 3: 87,802,667 T309I possibly damaging Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kif12 A C 4: 63,170,553 L170R probably damaging Het
Krt90 A G 15: 101,554,670 probably null Het
Mcu A G 10: 59,467,704 S104P probably damaging Het
Mical3 G A 6: 120,959,828 P374S probably benign Het
Ncam2 A T 16: 81,490,240 probably benign Het
Olfr1121 A G 2: 87,372,224 I231V probably benign Het
Olfr1369-ps1 T C 13: 21,115,842 L50P probably damaging Het
Olfr181 G A 16: 58,925,635 S312L probably benign Het
Olfr328 A T 11: 58,551,720 I173N probably damaging Het
Otud7a A G 7: 63,697,151 S158G probably benign Het
Phlpp1 C T 1: 106,172,839 T279M probably benign Het
Pkhd1l1 T G 15: 44,550,820 W2828G probably damaging Het
Pnmal1 A T 7: 16,960,391 N57I probably damaging Het
Ppp4r4 A G 12: 103,581,490 probably null Het
Ptprq T C 10: 107,686,599 Y531C probably damaging Het
Rai1 A G 11: 60,189,924 T1605A probably benign Het
Satb2 T C 1: 56,948,108 Y106C probably damaging Het
Slc19a3 T A 1: 83,023,035 H87L probably benign Het
Slc4a7 G T 14: 14,733,733 V54L probably damaging Het
Sp110 A C 1: 85,577,329 F434C probably benign Het
Spen T C 4: 141,477,905 N1137S unknown Het
Spice1 T C 16: 44,366,626 I162T probably benign Het
Sqor A T 2: 122,808,023 T396S probably benign Het
Tshz3 A T 7: 36,770,380 Q598L probably damaging Het
Ttc13 C T 8: 124,678,997 probably benign Het
Ubxn2a T C 12: 4,883,851 T187A probably benign Het
Usp28 T C 9: 49,037,258 probably null Het
Zc3h12a T C 4: 125,119,523 Y516C probably damaging Het
Zfp616 A C 11: 74,084,856 K650N probably damaging Het
Other mutations in Sgms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Sgms1 APN 19 32159625 missense probably damaging 1.00
IGL01585:Sgms1 APN 19 32142845 missense probably damaging 1.00
IGL02490:Sgms1 APN 19 32160143 missense probably damaging 0.98
IGL02970:Sgms1 APN 19 32159765 missense probably damaging 0.99
R1051:Sgms1 UTSW 19 32160039 missense probably damaging 1.00
R1871:Sgms1 UTSW 19 32159882 missense probably benign 0.01
R1971:Sgms1 UTSW 19 32159957 missense probably benign 0.05
R2001:Sgms1 UTSW 19 32159683 missense possibly damaging 0.94
R2405:Sgms1 UTSW 19 32159672 nonsense probably null
R2408:Sgms1 UTSW 19 32159672 nonsense probably null
R2410:Sgms1 UTSW 19 32159672 nonsense probably null
R3747:Sgms1 UTSW 19 32159594 missense possibly damaging 0.65
R4016:Sgms1 UTSW 19 32142792 missense possibly damaging 0.88
R4710:Sgms1 UTSW 19 32160137 missense probably damaging 1.00
R5056:Sgms1 UTSW 19 32159687 missense probably damaging 1.00
R5422:Sgms1 UTSW 19 32159832 missense probably damaging 0.98
R6023:Sgms1 UTSW 19 32124373 missense probably benign 0.12
R6106:Sgms1 UTSW 19 32124425 missense possibly damaging 0.87
R6932:Sgms1 UTSW 19 32142793 missense probably benign 0.02
R7207:Sgms1 UTSW 19 32142747 missense probably null 1.00
R7382:Sgms1 UTSW 19 32159782 missense possibly damaging 0.68
R7494:Sgms1 UTSW 19 32129691 missense probably benign 0.00
R7712:Sgms1 UTSW 19 32142769 missense probably benign 0.05
R7759:Sgms1 UTSW 19 32159876 missense probably benign
R7872:Sgms1 UTSW 19 32125365 missense probably damaging 0.99
R7955:Sgms1 UTSW 19 32125365 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGGCTGGATCTCAAGAGTG -3'
(R):5'- ATTGGCGTTGACATTCCCAAC -3'

Sequencing Primer
(F):5'- CATGGCTGGATCTCAAGAGTGTTTAC -3'
(R):5'- TGGCAGCTTCAGCATCAAG -3'
Posted On2014-11-11