Incidental Mutation 'R2447:Psmb5'
ID 248906
Institutional Source Beutler Lab
Gene Symbol Psmb5
Ensembl Gene ENSMUSG00000022193
Gene Name proteasome (prosome, macropain) subunit, beta type 5
Synonyms
Accession Numbers
Essential gene? Probably essential (E-score: 0.961) question?
Stock # R2447 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 54851577-54855452 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 54851927 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 86 (V86I)
Ref Sequence ENSEMBL: ENSMUSP00000154672 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022803] [ENSMUST00000227257]
AlphaFold O55234
Predicted Effect possibly damaging
Transcript: ENSMUST00000022803
AA Change: V173I

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022803
Gene: ENSMUSG00000022193
AA Change: V173I

DomainStartEndE-ValueType
low complexity region 17 42 N/A INTRINSIC
Pfam:Proteasome 56 238 8.3e-50 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102174
Predicted Effect probably damaging
Transcript: ENSMUST00000227257
AA Change: V86I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the proteasome B-type family, also known as the T1B family, that is a 20S core beta subunit in the proteasome. This catalytic subunit is not present in the immunoproteasome and is replaced by catalytic subunit 3i (proteasome beta 8 subunit). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2009]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Dnajc28 G A 16: 91,413,755 (GRCm39) T187M probably damaging Het
Fat3 G A 9: 15,909,567 (GRCm39) S2145F probably damaging Het
Foxo3 T C 10: 42,073,816 (GRCm39) I15V probably benign Het
Gm12888 A T 4: 121,175,547 (GRCm39) D78E possibly damaging Het
Gm4952 T A 19: 12,595,770 (GRCm39) N53K possibly damaging Het
Hrg A T 16: 22,779,898 (GRCm39) probably benign Het
Mta3 C T 17: 84,111,973 (GRCm39) T567I probably benign Het
Obscn T C 11: 59,022,472 (GRCm39) R758G possibly damaging Het
Panx1 A G 9: 14,956,185 (GRCm39) I50T probably damaging Het
Pdcd11 T C 19: 47,102,995 (GRCm39) F1114L probably benign Het
Phf6 C G X: 52,042,435 (GRCm39) Q279E probably benign Het
Phip A G 9: 82,797,452 (GRCm39) V517A probably damaging Het
R3hdm1 T A 1: 128,114,666 (GRCm39) probably benign Het
Sfmbt1 A G 14: 30,495,850 (GRCm39) I44M possibly damaging Het
Tmem89 A T 9: 108,743,868 (GRCm39) D56V probably damaging Het
Tns2 C T 15: 102,017,369 (GRCm39) R281C probably damaging Het
Tshz3 T A 7: 36,468,178 (GRCm39) C56S probably benign Het
Ttn C A 2: 76,778,284 (GRCm39) A1322S probably damaging Het
Ubr3 C T 2: 69,833,724 (GRCm39) H188Y probably damaging Het
Other mutations in Psmb5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Psmb5 APN 14 54,855,264 (GRCm39) missense possibly damaging 0.85
IGL02967:Psmb5 APN 14 54,854,083 (GRCm39) missense probably benign 0.11
IGL03095:Psmb5 APN 14 54,854,014 (GRCm39) missense probably damaging 1.00
R5651:Psmb5 UTSW 14 54,854,221 (GRCm39) missense possibly damaging 0.64
R6346:Psmb5 UTSW 14 54,854,130 (GRCm39) missense probably damaging 0.98
R6372:Psmb5 UTSW 14 54,854,130 (GRCm39) missense probably damaging 0.98
R6657:Psmb5 UTSW 14 54,851,840 (GRCm39) missense possibly damaging 0.61
R6687:Psmb5 UTSW 14 54,854,130 (GRCm39) missense probably damaging 0.98
R6688:Psmb5 UTSW 14 54,854,130 (GRCm39) missense probably damaging 0.98
R6752:Psmb5 UTSW 14 54,854,212 (GRCm39) missense probably benign 0.00
R7007:Psmb5 UTSW 14 54,854,166 (GRCm39) missense probably damaging 0.99
R7801:Psmb5 UTSW 14 54,854,212 (GRCm39) missense probably benign 0.00
R8066:Psmb5 UTSW 14 54,851,698 (GRCm39) missense probably benign 0.00
R8278:Psmb5 UTSW 14 54,855,342 (GRCm39) missense probably benign 0.13
R8497:Psmb5 UTSW 14 54,851,837 (GRCm39) missense possibly damaging 0.95
R8728:Psmb5 UTSW 14 54,855,261 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTCCGGAGTAGGCATCTCTGTA -3'
(R):5'- GCTCTGGAATCTGGAAATCTCAA -3'

Sequencing Primer
(F):5'- AGTAGGCATCTCTGTAGGTGG -3'
(R):5'- TAACTGCCGAGGAAGCTTTC -3'
Posted On 2014-11-12