Incidental Mutation 'R2448:Matn4'
ID248916
Institutional Source Beutler Lab
Gene Symbol Matn4
Ensembl Gene ENSMUSG00000016995
Gene Namematrilin 4
Synonymsmatrilin-4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2448 (G1)
Quality Score164
Status Not validated
Chromosome2
Chromosomal Location164389393-164405160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 164401850 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 24 (Q24L)
Ref Sequence ENSEMBL: ENSMUSP00000099393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017151] [ENSMUST00000103103] [ENSMUST00000103104] [ENSMUST00000109358] [ENSMUST00000109359]
Predicted Effect probably benign
Transcript: ENSMUST00000017151
SMART Domains Protein: ENSMUSP00000017151
Gene: ENSMUSG00000017007

DomainStartEndE-ValueType
LAG1_DNAbind 66 204 4.58e-78 SMART
BTD 205 357 1.23e-83 SMART
SCOP:d1a02n1 383 475 3e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103103
AA Change: Q24L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099392
Gene: ENSMUSG00000016995
AA Change: Q24L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000103104
AA Change: Q24L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000099393
Gene: ENSMUSG00000016995
AA Change: Q24L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.04e-3 SMART
EGF 261 298 3.43e-4 SMART
EGF 302 339 1.85e0 SMART
EGF 343 380 1.24e-1 SMART
VWA 386 564 6.72e-56 SMART
Matrilin_ccoil 574 621 2.39e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109356
Predicted Effect probably benign
Transcript: ENSMUST00000109358
AA Change: Q24L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000104982
Gene: ENSMUSG00000016995
AA Change: Q24L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 1.85e0 SMART
EGF 261 298 1.24e-1 SMART
VWA 304 482 6.72e-56 SMART
Matrilin_ccoil 492 539 2.39e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109359
AA Change: Q24L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104983
Gene: ENSMUSG00000016995
AA Change: Q24L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 34 209 8.6e-54 SMART
EGF 220 257 3.43e-4 SMART
EGF 261 298 1.85e0 SMART
EGF 302 339 1.24e-1 SMART
VWA 345 523 6.72e-56 SMART
Matrilin_ccoil 533 580 2.39e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154940
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of von Willebrand factor A domain-containing protein family. The proteins of this family are thought to be involved in the formation of filamentous networks in the extracellular matrices of various tissues. This family member is thought to be play a role in reorganizing and regenerating the corneal matrix in granular and lattice type I dystrophies. It may also be involved in wound healing in the dentin-pulp complex. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,499,748 I330N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a3 T C 1: 90,813,358 E784G probably damaging Het
Dis3 T C 14: 99,087,412 T528A probably damaging Het
Haus6 A T 4: 86,589,001 C453S possibly damaging Het
Megf6 A G 4: 154,266,645 probably null Het
Mut T C 17: 40,958,841 V697A probably damaging Het
Nectin3 A T 16: 46,448,515 probably null Het
Nell1 T A 7: 50,856,387 W781R probably damaging Het
Nrap C T 19: 56,322,030 R1511Q possibly damaging Het
Nup160 C T 2: 90,722,057 R1126W probably damaging Het
Phldb2 T C 16: 45,825,363 Y240C probably damaging Het
Pitpnm2 A G 5: 124,123,994 L874P probably damaging Het
Pole A G 5: 110,297,092 E438G probably damaging Het
Rbm33 A G 5: 28,342,417 Y195C probably benign Het
Robo4 C T 9: 37,402,662 P70S possibly damaging Het
Sdsl T C 5: 120,458,381 K323E probably benign Het
Stag1 T A 9: 100,888,409 V666E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Other mutations in Matn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Matn4 APN 2 164400743 missense probably damaging 0.97
IGL02188:Matn4 APN 2 164400866 missense probably benign 0.00
IGL02195:Matn4 APN 2 164401052 missense probably damaging 1.00
IGL02696:Matn4 APN 2 164396838 missense probably benign 0.09
IGL02927:Matn4 APN 2 164389837 missense probably damaging 1.00
R2021:Matn4 UTSW 2 164400653 missense probably damaging 1.00
R2022:Matn4 UTSW 2 164400653 missense probably damaging 1.00
R2272:Matn4 UTSW 2 164397242 missense possibly damaging 0.92
R4824:Matn4 UTSW 2 164393231 missense probably benign 0.01
R4839:Matn4 UTSW 2 164400976 missense probably benign 0.00
R5884:Matn4 UTSW 2 164404608 utr 5 prime probably benign
R5914:Matn4 UTSW 2 164393224 missense probably damaging 1.00
R6209:Matn4 UTSW 2 164400815 missense probably damaging 1.00
R6995:Matn4 UTSW 2 164389664 nonsense probably null
R7679:Matn4 UTSW 2 164389658 makesense probably null
R8035:Matn4 UTSW 2 164397040 missense not run
X0063:Matn4 UTSW 2 164397277 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAATTGAGGAAACAGCGCC -3'
(R):5'- ATACGCAAAGCCAGAGTGTTC -3'

Sequencing Primer
(F):5'- CGCCCGAGGGATGAAGTG -3'
(R):5'- AAGCCAGAGTGTTCATCCCCTG -3'
Posted On2014-11-12