Incidental Mutation 'R0305:Nxph1'
ID24892
Institutional Source Beutler Lab
Gene Symbol Nxph1
Ensembl Gene ENSMUSG00000046178
Gene Nameneurexophilin 1
Synonyms
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location8948431-9249032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 9247754 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 242 (I242F)
Ref Sequence ENSEMBL: ENSMUSP00000125274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060369] [ENSMUST00000160300]
Predicted Effect probably damaging
Transcript: ENSMUST00000060369
AA Change: I242F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060926
Gene: ENSMUSG00000046178
AA Change: I242F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
Pfam:Neurexophilin 63 271 1.2e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160300
AA Change: I242F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125274
Gene: ENSMUSG00000046178
AA Change: I242F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
Pfam:Neurexophilin 61 271 2.5e-115 PFAM
Meta Mutation Damage Score 0.4108 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the neurexophilin family and encodes a secreted protein with a variable N-terminal domain, a highly conserved, N-glycosylated central domain, a short linker region, and a cysteine-rich C-terminal domain. This protein forms a very tight complex with alpha neurexins, a group of proteins that promote adhesion between dendrites and axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation show no obvious morbidity, premature mortality, or anatomical defects. However, males exhibit sterility and testis abnormalities probably because homologous recombination results in co-insertion of the 5' part of the HSV-TK cassette into the targeted locus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Nxph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Nxph1 APN 6 9247743 missense probably damaging 1.00
IGL02256:Nxph1 APN 6 9247185 missense probably benign 0.13
IGL03229:Nxph1 APN 6 9247830 missense probably damaging 1.00
R1722:Nxph1 UTSW 6 9247516 missense probably damaging 1.00
R1899:Nxph1 UTSW 6 9247622 missense probably damaging 1.00
R2122:Nxph1 UTSW 6 9247791 missense probably damaging 1.00
R2274:Nxph1 UTSW 6 9247746 missense probably damaging 1.00
R5219:Nxph1 UTSW 6 9247765 nonsense probably null
R5715:Nxph1 UTSW 6 9247740 missense probably damaging 1.00
R6048:Nxph1 UTSW 6 9247103 missense probably benign
R7177:Nxph1 UTSW 6 9247497 missense probably damaging 1.00
X0017:Nxph1 UTSW 6 9247208 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGGCACAACAAACCGTGATTGATG -3'
(R):5'- AAGAGCAGCAAGGTAGACACATTCC -3'

Sequencing Primer
(F):5'- CCGTGATTGATGCTAAAGATTCC -3'
(R):5'- AGGCAACAGATGTGACCTTCTTC -3'
Posted On2013-04-16