Mutagenetix > Incidental Mutation

Incidental Mutation 'R2448:Nell1'

248924

Institutional Source

Beutler Lab

Gene Symbol

Nell1

Ensembl Gene

ENSMUSG00000055409

Gene Name

NEL-like 1

Synonyms

l7R6, B230343H07Rik

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2448 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

49625098-50513037 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 50506135 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Arginine at position 781 (W781R)

Ref Sequence

ENSEMBL: ENSMUSP00000080550 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081872] [ENSMUST00000107603]

AlphaFold

Q2VWQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000081872
AA Change: W781R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080550
Gene: ENSMUSG00000055409
AA Change: W781R

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART
coiled coil region	240	266	N/A	INTRINSIC
VWC	273	331	1.45e-6	SMART
VWC	335	389	1.34e0	SMART
EGF	394	433	1.06e0	SMART
EGF_CA	434	475	7.93e-9	SMART
EGF	479	516	1.1e-2	SMART
EGF	518	547	8.32e-3	SMART
EGF_CA	549	595	1.08e-10	SMART
EGF_like	596	635	1.84e-4	SMART
VWC	634	686	1.42e0	SMART
VWC	694	749	1.83e-12	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107603
AA Change: W734R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103229
Gene: ENSMUSG00000055409
AA Change: W734R

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
TSPN	29	213	8.5e-72	SMART
LamG	81	208	1.77e-14	SMART
coiled coil region	240	266	N/A	INTRINSIC
VWC	273	331	1.45e-6	SMART
VWC	335	389	1.34e0	SMART
EGF	394	433	1.06e0	SMART
EGF_CA	434	475	7.93e-9	SMART
EGF	479	516	1.1e-2	SMART
EGF	518	547	8.32e-3	SMART
EGF_like	549	588	1.84e-4	SMART
VWC	587	639	1.42e0	SMART
VWC	647	702	1.83e-12	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.0%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein that contains epidermal growth factor (EGF)-like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynostosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Homozygous mice display perinatal lethality, respiratory failure, impaired development of the intervertebral disks, vertebrae and calvarial bones, increased skull length, and abnormal curvature of the spine. [provided by MGI curators]

Allele List at MGI

All alleles(11) : Gene trapped(2) Chemically induced(9)

Other mutations in this stock

Total: 19 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl3	T	A	7: 82,148,956 (GRCm39)	I330N	probably damaging	Het
Col1a2	G	A	6: 4,518,822 (GRCm39)		probably benign	Het
Col6a3	T	C	1: 90,741,080 (GRCm39)	E784G	probably damaging	Het
Dis3	T	C	14: 99,324,848 (GRCm39)	T528A	probably damaging	Het
Haus6	A	T	4: 86,507,238 (GRCm39)	C453S	possibly damaging	Het
Matn4	T	A	2: 164,243,770 (GRCm39)	Q24L	probably benign	Het
Megf6	A	G	4: 154,351,102 (GRCm39)		probably null	Het
Mmut	T	C	17: 41,269,732 (GRCm39)	V697A	probably damaging	Het
Nectin3	A	T	16: 46,268,878 (GRCm39)		probably null	Het
Nrap	C	T	19: 56,310,462 (GRCm39)	R1511Q	possibly damaging	Het
Nup160	C	T	2: 90,552,401 (GRCm39)	R1126W	probably damaging	Het
Phldb2	T	C	16: 45,645,726 (GRCm39)	Y240C	probably damaging	Het
Pitpnm2	A	G	5: 124,262,057 (GRCm39)	L874P	probably damaging	Het
Pole	A	G	5: 110,444,958 (GRCm39)	E438G	probably damaging	Het
Rbm33	A	G	5: 28,547,415 (GRCm39)	Y195C	probably benign	Het
Robo4	C	T	9: 37,313,958 (GRCm39)	P70S	possibly damaging	Het
Sdsl	T	C	5: 120,596,446 (GRCm39)	K323E	probably benign	Het
Stag1	T	A	9: 100,770,462 (GRCm39)	V666E	probably benign	Het
Tns2	C	T	15: 102,017,369 (GRCm39)	R281C	probably damaging	Het

Other mutations in Nell1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00327:Nell1	APN	7	49,770,421 (GRCm39)	missense	probably damaging	0.96
IGL01434:Nell1	APN	7	50,350,956 (GRCm39)	missense	probably benign	0.01
IGL01796:Nell1	APN	7	49,825,964 (GRCm39)	splice site	probably benign
IGL02048:Nell1	APN	7	49,869,355 (GRCm39)	missense	probably damaging	0.96
IGL02239:Nell1	APN	7	49,899,398 (GRCm39)	missense	probably benign	0.08
IGL02860:Nell1	APN	7	50,498,233 (GRCm39)	missense	probably damaging	0.99
IGL02958:Nell1	APN	7	49,870,085 (GRCm39)	critical splice donor site	probably null
IGL03143:Nell1	APN	7	49,929,281 (GRCm39)	nonsense	probably null
IGL03334:Nell1	APN	7	49,712,359 (GRCm39)	splice site	probably null
D6062:Nell1	UTSW	7	49,907,939 (GRCm39)	missense	probably benign	0.21
P0018:Nell1	UTSW	7	49,770,439 (GRCm39)	missense	probably damaging	1.00
R0004:Nell1	UTSW	7	50,210,507 (GRCm39)	splice site	probably benign
R0029:Nell1	UTSW	7	49,770,463 (GRCm39)	splice site	probably benign
R0029:Nell1	UTSW	7	49,770,463 (GRCm39)	splice site	probably benign
R0468:Nell1	UTSW	7	49,878,594 (GRCm39)	missense	probably damaging	0.97
R0483:Nell1	UTSW	7	49,879,928 (GRCm39)	missense	probably benign	0.07
R0732:Nell1	UTSW	7	50,506,135 (GRCm39)	missense	probably damaging	1.00
R0945:Nell1	UTSW	7	49,869,333 (GRCm39)	missense	probably benign	0.07
R1022:Nell1	UTSW	7	49,770,411 (GRCm39)	missense	probably damaging	1.00
R1024:Nell1	UTSW	7	49,770,411 (GRCm39)	missense	probably damaging	1.00
R1075:Nell1	UTSW	7	50,503,588 (GRCm39)	missense	probably damaging	0.98
R1291:Nell1	UTSW	7	49,879,998 (GRCm39)	missense	probably benign	0.00
R1404:Nell1	UTSW	7	50,503,621 (GRCm39)	missense	possibly damaging	0.91
R1404:Nell1	UTSW	7	50,503,621 (GRCm39)	missense	possibly damaging	0.91
R1634:Nell1	UTSW	7	50,498,306 (GRCm39)	missense	possibly damaging	0.82
R1928:Nell1	UTSW	7	50,350,943 (GRCm39)	missense	possibly damaging	0.51
R2060:Nell1	UTSW	7	50,210,578 (GRCm39)	missense	possibly damaging	0.58
R2261:Nell1	UTSW	7	50,210,569 (GRCm39)	missense	possibly damaging	0.95
R2262:Nell1	UTSW	7	50,210,569 (GRCm39)	missense	possibly damaging	0.95
R2263:Nell1	UTSW	7	50,210,569 (GRCm39)	missense	possibly damaging	0.95
R2869:Nell1	UTSW	7	49,899,405 (GRCm39)	intron	probably benign
R2870:Nell1	UTSW	7	49,899,405 (GRCm39)	intron	probably benign
R2871:Nell1	UTSW	7	49,899,405 (GRCm39)	intron	probably benign
R3498:Nell1	UTSW	7	49,907,927 (GRCm39)	missense	possibly damaging	0.55
R4044:Nell1	UTSW	7	49,869,367 (GRCm39)	missense	probably damaging	1.00
R4623:Nell1	UTSW	7	49,770,310 (GRCm39)	missense	possibly damaging	0.84
R4732:Nell1	UTSW	7	50,505,965 (GRCm39)	missense	probably damaging	1.00
R4733:Nell1	UTSW	7	50,505,965 (GRCm39)	missense	probably damaging	1.00
R4941:Nell1	UTSW	7	49,712,386 (GRCm39)	missense	probably benign	0.10
R4942:Nell1	UTSW	7	49,770,397 (GRCm39)	missense	possibly damaging	0.84
R5233:Nell1	UTSW	7	49,826,062 (GRCm39)	missense	probably damaging	0.99
R5590:Nell1	UTSW	7	49,929,359 (GRCm39)	missense	probably damaging	1.00
R5673:Nell1	UTSW	7	49,878,594 (GRCm39)	missense	probably damaging	0.99
R5741:Nell1	UTSW	7	50,210,638 (GRCm39)	splice site	probably null
R6345:Nell1	UTSW	7	49,625,171 (GRCm39)	missense	possibly damaging	0.91
R6916:Nell1	UTSW	7	50,350,927 (GRCm39)	missense	probably benign	0.00
R7051:Nell1	UTSW	7	50,098,592 (GRCm39)	missense	unknown
R7302:Nell1	UTSW	7	50,506,017 (GRCm39)	missense	probably benign
R7339:Nell1	UTSW	7	49,929,297 (GRCm39)	missense	probably benign	0.01
R7831:Nell1	UTSW	7	49,632,548 (GRCm39)	missense	possibly damaging	0.85
R7913:Nell1	UTSW	7	49,929,270 (GRCm39)	missense	possibly damaging	0.93
R8094:Nell1	UTSW	7	49,770,335 (GRCm39)	missense	probably benign	0.02
R8191:Nell1	UTSW	7	50,098,622 (GRCm39)	missense	unknown
R8207:Nell1	UTSW	7	49,869,760 (GRCm39)	splice site	probably null
R8292:Nell1	UTSW	7	49,907,995 (GRCm39)	missense	probably damaging	1.00
R8340:Nell1	UTSW	7	49,870,021 (GRCm39)	missense	probably damaging	0.98
R8673:Nell1	UTSW	7	49,869,343 (GRCm39)	missense	probably damaging	1.00
R8821:Nell1	UTSW	7	50,476,097 (GRCm39)	missense	probably damaging	0.98
R8987:Nell1	UTSW	7	50,498,399 (GRCm39)	missense	probably damaging	1.00
R8988:Nell1	UTSW	7	50,210,543 (GRCm39)	missense	unknown
R9095:Nell1	UTSW	7	50,506,150 (GRCm39)	missense	possibly damaging	0.92
R9300:Nell1	UTSW	7	49,712,368 (GRCm39)	missense	probably benign
R9370:Nell1	UTSW	7	49,770,292 (GRCm39)	missense	probably damaging	1.00
R9422:Nell1	UTSW	7	49,712,387 (GRCm39)	nonsense	probably null
R9428:Nell1	UTSW	7	50,503,683 (GRCm39)	missense	probably damaging	1.00
R9445:Nell1	UTSW	7	49,632,474 (GRCm39)	missense	possibly damaging	0.78
Z1176:Nell1	UTSW	7	50,210,630 (GRCm39)	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCATCTTTCTCTCCACAGGAAGG -3'
(R):5'- GGCAAATTTGTATTACTCCACGTC -3'

Sequencing Primer
(F):5'- GGAGAGGCAGACTGCTGG -3'
(R):5'- TGGAAACTGCCTTTATACGAGGACC -3'

Posted On

2014-11-12