Incidental Mutation 'R2448:Dis3'
ID248929
Institutional Source Beutler Lab
Gene Symbol Dis3
Ensembl Gene ENSMUSG00000033166
Gene NameDIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease
Synonyms2810028N01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2448 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location99075206-99099770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99087412 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 528 (T528A)
Ref Sequence ENSEMBL: ENSMUSP00000041906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042471] [ENSMUST00000227022] [ENSMUST00000228643]
Predicted Effect probably damaging
Transcript: ENSMUST00000042471
AA Change: T528A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041906
Gene: ENSMUSG00000033166
AA Change: T528A

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
PINc 64 182 2.8e-24 SMART
low complexity region 425 436 N/A INTRINSIC
RNB 467 797 5.56e-141 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228449
Predicted Effect probably damaging
Transcript: ENSMUST00000228643
AA Change: T528A

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,499,748 I330N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a3 T C 1: 90,813,358 E784G probably damaging Het
Haus6 A T 4: 86,589,001 C453S possibly damaging Het
Matn4 T A 2: 164,401,850 Q24L probably benign Het
Megf6 A G 4: 154,266,645 probably null Het
Mut T C 17: 40,958,841 V697A probably damaging Het
Nectin3 A T 16: 46,448,515 probably null Het
Nell1 T A 7: 50,856,387 W781R probably damaging Het
Nrap C T 19: 56,322,030 R1511Q possibly damaging Het
Nup160 C T 2: 90,722,057 R1126W probably damaging Het
Phldb2 T C 16: 45,825,363 Y240C probably damaging Het
Pitpnm2 A G 5: 124,123,994 L874P probably damaging Het
Pole A G 5: 110,297,092 E438G probably damaging Het
Rbm33 A G 5: 28,342,417 Y195C probably benign Het
Robo4 C T 9: 37,402,662 P70S possibly damaging Het
Sdsl T C 5: 120,458,381 K323E probably benign Het
Stag1 T A 9: 100,888,409 V666E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Other mutations in Dis3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Dis3 APN 14 99082674 missense probably damaging 1.00
IGL00821:Dis3 APN 14 99091486 missense probably benign 0.00
IGL00975:Dis3 APN 14 99079234 missense probably damaging 1.00
IGL01536:Dis3 APN 14 99079423 missense probably damaging 1.00
IGL01538:Dis3 APN 14 99097745 missense probably benign 0.00
IGL02143:Dis3 APN 14 99091318 splice site probably benign
IGL02270:Dis3 APN 14 99078354 missense probably benign 0.01
IGL02354:Dis3 APN 14 99079712 nonsense probably null
IGL02361:Dis3 APN 14 99079712 nonsense probably null
IGL02650:Dis3 APN 14 99098785 missense probably benign 0.00
IGL03053:Dis3 APN 14 99098734 missense probably benign 0.00
IGL03057:Dis3 APN 14 99089990 missense possibly damaging 0.95
IGL03389:Dis3 APN 14 99095347 splice site probably benign
R0415:Dis3 UTSW 14 99087456 missense probably damaging 1.00
R0504:Dis3 UTSW 14 99081390 splice site probably benign
R1535:Dis3 UTSW 14 99079426 missense probably damaging 1.00
R1756:Dis3 UTSW 14 99086103 missense probably damaging 1.00
R1767:Dis3 UTSW 14 99084142 missense probably damaging 1.00
R1883:Dis3 UTSW 14 99091469 missense probably benign 0.21
R1938:Dis3 UTSW 14 99097590 missense probably benign 0.09
R2056:Dis3 UTSW 14 99098815 missense possibly damaging 0.90
R2133:Dis3 UTSW 14 99079877 missense probably benign 0.18
R3407:Dis3 UTSW 14 99098776 missense probably benign 0.15
R4052:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4207:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4208:Dis3 UTSW 14 99095316 missense probably benign 0.00
R4465:Dis3 UTSW 14 99084114 missense possibly damaging 0.88
R4612:Dis3 UTSW 14 99091435 missense probably benign 0.07
R4859:Dis3 UTSW 14 99087790 missense probably damaging 1.00
R4932:Dis3 UTSW 14 99088904 missense probably damaging 1.00
R5273:Dis3 UTSW 14 99098806 missense probably benign 0.32
R5335:Dis3 UTSW 14 99097653 missense possibly damaging 0.72
R5409:Dis3 UTSW 14 99085932 missense possibly damaging 0.95
R5802:Dis3 UTSW 14 99099664 missense probably damaging 1.00
R6156:Dis3 UTSW 14 99098779 missense probably benign 0.10
R6309:Dis3 UTSW 14 99085922 missense probably benign 0.00
R7275:Dis3 UTSW 14 99087489 missense probably damaging 1.00
R7511:Dis3 UTSW 14 99099606 missense possibly damaging 0.94
R7535:Dis3 UTSW 14 99089979 missense probably benign 0.15
R7794:Dis3 UTSW 14 99098797 missense probably benign 0.04
R8013:Dis3 UTSW 14 99077399 missense not run
R8014:Dis3 UTSW 14 99077399 missense not run
Predicted Primers PCR Primer
(F):5'- GGACACCTTCATCCATGCATTG -3'
(R):5'- GACCAAGTCCATTTTCTGTTTAGC -3'

Sequencing Primer
(F):5'- GACTGTGATTGCTCATGAAACC -3'
(R):5'- GTCCATTTTCTGTTTAGCTACATTTC -3'
Posted On2014-11-12