Incidental Mutation 'R2448:Mut'
ID248933
Institutional Source Beutler Lab
Gene Symbol Mut
Ensembl Gene ENSMUSG00000023921
Gene Namemethylmalonyl-Coenzyme A mutase
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2448 (G1)
Quality Score200
Status Not validated
Chromosome17
Chromosomal Location40934685-40961989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 40958841 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 697 (V697A)
Ref Sequence ENSEMBL: ENSMUSP00000130941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169611]
Predicted Effect probably damaging
Transcript: ENSMUST00000169611
AA Change: V697A

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130941
Gene: ENSMUSG00000023921
AA Change: V697A

DomainStartEndE-ValueType
Pfam:MM_CoA_mutase 60 572 3.7e-240 PFAM
Pfam:B12-binding 613 731 4.7e-17 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme methylmalonyl Coenzyme A mutase. In humans, the product of this gene is a vitamin B12-dependent enzyme which catalyzes the isomerization of methylmalonyl-CoA to succinyl-CoA, while in other species this enzyme may have different functions. Mutations in this gene may lead to various types of methylmalonic aciduria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die within 1 day of birth exhibiting symptoms similar to those observed in patients with methylmalonic aciduria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamtsl3 T A 7: 82,499,748 I330N probably damaging Het
Col1a2 G A 6: 4,518,822 probably benign Het
Col6a3 T C 1: 90,813,358 E784G probably damaging Het
Dis3 T C 14: 99,087,412 T528A probably damaging Het
Haus6 A T 4: 86,589,001 C453S possibly damaging Het
Matn4 T A 2: 164,401,850 Q24L probably benign Het
Megf6 A G 4: 154,266,645 probably null Het
Nectin3 A T 16: 46,448,515 probably null Het
Nell1 T A 7: 50,856,387 W781R probably damaging Het
Nrap C T 19: 56,322,030 R1511Q possibly damaging Het
Nup160 C T 2: 90,722,057 R1126W probably damaging Het
Phldb2 T C 16: 45,825,363 Y240C probably damaging Het
Pitpnm2 A G 5: 124,123,994 L874P probably damaging Het
Pole A G 5: 110,297,092 E438G probably damaging Het
Rbm33 A G 5: 28,342,417 Y195C probably benign Het
Robo4 C T 9: 37,402,662 P70S possibly damaging Het
Sdsl T C 5: 120,458,381 K323E probably benign Het
Stag1 T A 9: 100,888,409 V666E probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Other mutations in Mut
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01482:Mut APN 17 40956271 missense probably damaging 0.99
IGL01666:Mut APN 17 40958811 missense probably damaging 1.00
IGL02141:Mut APN 17 40938817 missense possibly damaging 0.68
IGL02257:Mut APN 17 40938734 missense possibly damaging 0.78
IGL02538:Mut APN 17 40938619 missense probably damaging 1.00
mix UTSW 17 40941383 missense possibly damaging 0.66
mongrel UTSW 17 40938731 missense possibly damaging 0.77
R0115:Mut UTSW 17 40956227 missense probably damaging 1.00
R0381:Mut UTSW 17 40937258 missense probably benign 0.04
R0603:Mut UTSW 17 40947166 missense probably damaging 0.99
R0928:Mut UTSW 17 40937283 missense probably benign 0.24
R1292:Mut UTSW 17 40941407 missense probably damaging 1.00
R1452:Mut UTSW 17 40937468 splice site probably benign
R1460:Mut UTSW 17 40937375 missense probably damaging 1.00
R2044:Mut UTSW 17 40941451 missense probably benign 0.00
R2256:Mut UTSW 17 40956319 missense probably benign 0.02
R3113:Mut UTSW 17 40958356 missense probably damaging 1.00
R3176:Mut UTSW 17 40958872 splice site probably null
R3276:Mut UTSW 17 40958872 splice site probably null
R3894:Mut UTSW 17 40955139 missense probably damaging 0.97
R4624:Mut UTSW 17 40947055 missense probably damaging 1.00
R4801:Mut UTSW 17 40937351 missense probably benign 0.08
R4802:Mut UTSW 17 40937351 missense probably benign 0.08
R5031:Mut UTSW 17 40938827 missense possibly damaging 0.96
R5394:Mut UTSW 17 40947184 missense probably benign 0.02
R5651:Mut UTSW 17 40947111 missense probably damaging 1.00
R6225:Mut UTSW 17 40938731 missense possibly damaging 0.77
R6274:Mut UTSW 17 40956245 missense probably benign 0.00
R7002:Mut UTSW 17 40941383 missense possibly damaging 0.66
R7141:Mut UTSW 17 40952839 missense possibly damaging 0.68
R7203:Mut UTSW 17 40938673 missense probably benign 0.06
R7868:Mut UTSW 17 40947043 missense probably damaging 1.00
R8050:Mut UTSW 17 40943893 missense probably benign 0.06
R8228:Mut UTSW 17 40937328 missense possibly damaging 0.92
RF021:Mut UTSW 17 40951758 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AATAGGACTTGCTTCACCCTTACC -3'
(R):5'- ACTGAGCCGCCTAAGAACTC -3'

Sequencing Primer
(F):5'- TCACCCTTACCTTGTAATAACCAG -3'
(R):5'- GAACTCCAGTCTTAACCAGTGTGG -3'
Posted On2014-11-12