Incidental Mutation 'R2449:Trim63'
ID248939
Institutional Source Beutler Lab
Gene Symbol Trim63
Ensembl Gene ENSMUSG00000028834
Gene Nametripartite motif-containing 63
SynonymsMuRF1, Rnf28
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2449 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location134315120-134329629 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 134323107 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 234 (E234G)
Ref Sequence ENSEMBL: ENSMUSP00000101501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030638] [ENSMUST00000105875]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030638
AA Change: E234G

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030638
Gene: ENSMUSG00000028834
AA Change: E234G

DomainStartEndE-ValueType
RING 23 78 1.4e-8 SMART
BBOX 117 159 1.41e-4 SMART
Blast:BBC 166 292 3e-75 BLAST
PDB:4M3L|D 213 271 3e-28 PDB
low complexity region 324 350 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105875
AA Change: E234G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000101501
Gene: ENSMUSG00000028834
AA Change: E234G

DomainStartEndE-ValueType
RING 23 78 1.4e-8 SMART
BBOX 117 159 1.41e-4 SMART
Blast:BBC 166 292 3e-75 BLAST
PDB:4M3L|D 213 271 3e-28 PDB
low complexity region 323 353 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135576
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RING zinc finger protein family found in striated muscle and iris. The product of this gene is an E3 ubiquitin ligase that localizes to the Z-line and M-line lattices of myofibrils. This protein plays an important role in the atrophy of skeletal and cardiac muscle and is required for the degradation of myosin heavy chain proteins, myosin light chain, myosin binding protein, and for muscle-type creatine kinase. [provided by RefSeq, Feb 2012]
PHENOTYPE: A targeted homozygous mutation in this gene results in resistance to skeletal muscle atrophy in response to nerve injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Cd83 A T 13: 43,797,656 T95S probably damaging Het
Cdc27 T C 11: 104,505,638 D819G probably benign Het
Hey2 A T 10: 30,840,446 I64K possibly damaging Het
Il10rb A G 16: 91,411,903 H67R probably benign Het
Itgav T A 2: 83,768,750 probably null Het
Lhx1 G A 11: 84,521,738 R119C probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr527 A T 7: 140,336,432 Q190L probably benign Het
Siglec1 T C 2: 131,078,725 T720A probably benign Het
Sycp1 T C 3: 102,925,206 I215V probably benign Het
Vmn2r56 C T 7: 12,694,155 S728N possibly damaging Het
Wdr64 A T 1: 175,698,913 I43L probably benign Het
Wsb1 T C 11: 79,240,352 K406R probably benign Het
Other mutations in Trim63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Trim63 APN 4 134325676 missense probably benign 0.00
murfy UTSW 4 134323101 missense probably damaging 1.00
FR4737:Trim63 UTSW 4 134327725 small deletion probably benign
PIT1430001:Trim63 UTSW 4 134321173 splice site probably benign
R0690:Trim63 UTSW 4 134316405 missense probably benign 0.00
R1782:Trim63 UTSW 4 134323038 missense probably benign
R1881:Trim63 UTSW 4 134316391 missense probably damaging 0.98
R2917:Trim63 UTSW 4 134323151 missense probably damaging 1.00
R2939:Trim63 UTSW 4 134322997 splice site probably benign
R3746:Trim63 UTSW 4 134315354 missense probably damaging 1.00
R3833:Trim63 UTSW 4 134321196 missense probably benign 0.33
R5276:Trim63 UTSW 4 134323133 missense probably benign 0.00
R5823:Trim63 UTSW 4 134316531 missense probably damaging 1.00
R6251:Trim63 UTSW 4 134323226 missense probably benign 0.00
R6312:Trim63 UTSW 4 134325697 missense probably damaging 1.00
R6893:Trim63 UTSW 4 134323101 missense probably damaging 1.00
R6924:Trim63 UTSW 4 134321261 missense probably damaging 0.96
R8368:Trim63 UTSW 4 134327706 small deletion probably benign
X0027:Trim63 UTSW 4 134327706 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TCTTGCTGCAGATAGTTCCTGG -3'
(R):5'- ACCAAGATTTGAACGGCCC -3'

Sequencing Primer
(F):5'- AGATAGTTCCTGGGGCCCTTC -3'
(R):5'- CCCGTTCGAGGGTTAAGAAAGTC -3'
Posted On2014-11-12