Incidental Mutation 'R2449:Olfr527'
ID248942
Institutional Source Beutler Lab
Gene Symbol Olfr527
Ensembl Gene ENSMUSG00000062782
Gene Nameolfactory receptor 527
SynonymsGA_x6K02T2PBJ9-42486061-42486978, MOR251-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2449 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140334017-140338551 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140336432 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 190 (Q190L)
Ref Sequence ENSEMBL: ENSMUSP00000149080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172230] [ENSMUST00000214143] [ENSMUST00000214858]
Predicted Effect probably benign
Transcript: ENSMUST00000172230
AA Change: Q190L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129414
Gene: ENSMUSG00000062782
AA Change: Q190L

DomainStartEndE-ValueType
Pfam:7tm_4 29 304 1.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 33 179 9.1e-8 PFAM
Pfam:7tm_1 39 287 7.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214143
AA Change: Q190L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000214858
AA Change: Q190L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Cd83 A T 13: 43,797,656 T95S probably damaging Het
Cdc27 T C 11: 104,505,638 D819G probably benign Het
Hey2 A T 10: 30,840,446 I64K possibly damaging Het
Il10rb A G 16: 91,411,903 H67R probably benign Het
Itgav T A 2: 83,768,750 probably null Het
Lhx1 G A 11: 84,521,738 R119C probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Siglec1 T C 2: 131,078,725 T720A probably benign Het
Sycp1 T C 3: 102,925,206 I215V probably benign Het
Trim63 A G 4: 134,323,107 E234G probably damaging Het
Vmn2r56 C T 7: 12,694,155 S728N possibly damaging Het
Wdr64 A T 1: 175,698,913 I43L probably benign Het
Wsb1 T C 11: 79,240,352 K406R probably benign Het
Other mutations in Olfr527
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02818:Olfr527 APN 7 140336606 missense possibly damaging 0.90
IGL02885:Olfr527 APN 7 140336159 missense possibly damaging 0.94
R1340:Olfr527 UTSW 7 140336125 missense probably benign 0.10
R1711:Olfr527 UTSW 7 140335999 missense possibly damaging 0.55
R1860:Olfr527 UTSW 7 140336219 missense possibly damaging 0.78
R2042:Olfr527 UTSW 7 140335937 missense probably damaging 1.00
R2072:Olfr527 UTSW 7 140336653 missense possibly damaging 0.85
R2128:Olfr527 UTSW 7 140336429 missense probably damaging 1.00
R2347:Olfr527 UTSW 7 140336147 missense probably damaging 0.98
R2973:Olfr527 UTSW 7 140336387 missense probably damaging 1.00
R3151:Olfr527 UTSW 7 140336330 missense probably benign 0.01
R4320:Olfr527 UTSW 7 140336306 missense possibly damaging 0.94
R5561:Olfr527 UTSW 7 140336152 nonsense probably null
R5566:Olfr527 UTSW 7 140336067 missense probably damaging 1.00
R5891:Olfr527 UTSW 7 140336600 missense probably benign 0.06
R7227:Olfr527 UTSW 7 140335621 start gained probably benign
R7296:Olfr527 UTSW 7 140336741 missense possibly damaging 0.91
R7568:Olfr527 UTSW 7 140335982 missense probably damaging 1.00
R8000:Olfr527 UTSW 7 140336342 missense possibly damaging 0.61
R8171:Olfr527 UTSW 7 140336230 missense probably damaging 1.00
R8203:Olfr527 UTSW 7 140336026 missense probably benign 0.14
R8351:Olfr527 UTSW 7 140336605 missense probably damaging 1.00
R8451:Olfr527 UTSW 7 140336605 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCCTATGACCGCTTTGTG -3'
(R):5'- GTACATGGTGACCACGATAAGG -3'

Sequencing Primer
(F):5'- CACTACAGTGCTTGGATGGGC -3'
(R):5'- TGACCACGATAAGGTGTGC -3'
Posted On2014-11-12