Incidental Mutation 'R2449:Hey2'
ID248943
Institutional Source Beutler Lab
Gene Symbol Hey2
Ensembl Gene ENSMUSG00000019789
Gene Namehairy/enhancer-of-split related with YRPW motif 2
SynonymsbHLHb32, Hesr2, CHF1, Herp1, Hrt2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R2449 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location30832359-30842801 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 30840446 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 64 (I64K)
Ref Sequence ENSEMBL: ENSMUSP00000019924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019924]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019924
AA Change: I64K

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019924
Gene: ENSMUSG00000019789
AA Change: I64K

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
HLH 54 109 6.71e-16 SMART
ORANGE 119 166 5.55e-18 SMART
low complexity region 174 193 N/A INTRINSIC
low complexity region 253 277 N/A INTRINSIC
low complexity region 293 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217504
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hairy and enhancer of split-related (HESR) family of basic helix-loop-helix (bHLH)-type transcription factors. The encoded protein forms homo- or hetero-dimers that localize to the nucleus and interact with a histone deacetylase complex to repress transcription. Expression of this gene is induced by the Notch signal transduction pathway. Two similar and redundant genes in mouse are required for embryonic cardiovascular development, and are also implicated in neurogenesis and somitogenesis. Alternatively spliced transcript variants have been found, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit cardiac hypertrophy, ventricular septal defects, pulmonary and liver congestion, and reduced preweaning viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Cd83 A T 13: 43,797,656 T95S probably damaging Het
Cdc27 T C 11: 104,505,638 D819G probably benign Het
Il10rb A G 16: 91,411,903 H67R probably benign Het
Itgav T A 2: 83,768,750 probably null Het
Lhx1 G A 11: 84,521,738 R119C probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr527 A T 7: 140,336,432 Q190L probably benign Het
Siglec1 T C 2: 131,078,725 T720A probably benign Het
Sycp1 T C 3: 102,925,206 I215V probably benign Het
Trim63 A G 4: 134,323,107 E234G probably damaging Het
Vmn2r56 C T 7: 12,694,155 S728N possibly damaging Het
Wdr64 A T 1: 175,698,913 I43L probably benign Het
Wsb1 T C 11: 79,240,352 K406R probably benign Het
Other mutations in Hey2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01681:Hey2 APN 10 30834137 missense probably benign 0.25
IGL02525:Hey2 APN 10 30842647 start codon destroyed probably null 0.99
R0167:Hey2 UTSW 10 30840665 missense probably benign 0.04
R0279:Hey2 UTSW 10 30834010 missense probably damaging 0.97
R0553:Hey2 UTSW 10 30840489 splice site probably benign
R0592:Hey2 UTSW 10 30833957 missense probably benign 0.44
R0621:Hey2 UTSW 10 30834386 missense probably benign 0.36
R1437:Hey2 UTSW 10 30833849 missense probably benign 0.00
R1457:Hey2 UTSW 10 30834356 missense probably benign 0.45
R4721:Hey2 UTSW 10 30834308 missense possibly damaging 0.65
R4755:Hey2 UTSW 10 30834304 missense probably benign 0.00
R4828:Hey2 UTSW 10 30834183 missense possibly damaging 0.95
R5419:Hey2 UTSW 10 30834023 missense probably benign
R6927:Hey2 UTSW 10 30834417 missense probably benign 0.16
R7079:Hey2 UTSW 10 30834386 missense probably benign 0.36
R8196:Hey2 UTSW 10 30834277 missense probably benign
R8238:Hey2 UTSW 10 30840663 missense probably benign
R8381:Hey2 UTSW 10 30833990 missense probably damaging 1.00
R8383:Hey2 UTSW 10 30840669 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTTCTACGCCGGATCAGAG -3'
(R):5'- TGAGGTCCAATTCACCGACAAC -3'

Sequencing Primer
(F):5'- TACGCCGGATCAGAGTGTGC -3'
(R):5'- ACTACCTCTCAGATTATGGCAAG -3'
Posted On2014-11-12