Incidental Mutation 'R2449:Wsb1'
ID248945
Institutional Source Beutler Lab
Gene Symbol Wsb1
Ensembl Gene ENSMUSG00000017677
Gene NameWD repeat and SOCS box-containing 1
Synonyms
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R2449 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location79239372-79254671 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79240352 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 406 (K406R)
Ref Sequence ENSEMBL: ENSMUSP00000017821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017821] [ENSMUST00000131848] [ENSMUST00000145772]
Predicted Effect probably benign
Transcript: ENSMUST00000017821
AA Change: K406R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000017821
Gene: ENSMUSG00000017677
AA Change: K406R

DomainStartEndE-ValueType
Blast:WD40 25 62 2e-16 BLAST
WD40 117 156 8.4e-2 SMART
WD40 159 199 2.5e-10 SMART
WD40 203 242 5.9e-10 SMART
WD40 245 284 2.9e-11 SMART
WD40 300 339 1.2e-5 SMART
WD40 342 379 1.1e-4 SMART
SOCS 378 420 2.7e-18 SMART
SOCS_box 384 420 4.1e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131818
SMART Domains Protein: ENSMUSP00000131290
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
WD40 48 87 1.33e1 SMART
WD40 90 130 3.72e-8 SMART
WD40 134 172 4.18e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131848
SMART Domains Protein: ENSMUSP00000128181
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
Blast:WD40 25 62 2e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137890
Predicted Effect probably benign
Transcript: ENSMUST00000145772
SMART Domains Protein: ENSMUSP00000137999
Gene: ENSMUSG00000017677

DomainStartEndE-ValueType
Blast:WD40 25 62 3e-19 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153585
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD-protein subfamily. This protein shares a high sequence identity to mouse and chick proteins. It contains several WD-repeats spanning most of the protein and an SOCS box in the C-terminus. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
Cd83 A T 13: 43,797,656 T95S probably damaging Het
Cdc27 T C 11: 104,505,638 D819G probably benign Het
Hey2 A T 10: 30,840,446 I64K possibly damaging Het
Il10rb A G 16: 91,411,903 H67R probably benign Het
Itgav T A 2: 83,768,750 probably null Het
Lhx1 G A 11: 84,521,738 R119C probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr527 A T 7: 140,336,432 Q190L probably benign Het
Siglec1 T C 2: 131,078,725 T720A probably benign Het
Sycp1 T C 3: 102,925,206 I215V probably benign Het
Trim63 A G 4: 134,323,107 E234G probably damaging Het
Vmn2r56 C T 7: 12,694,155 S728N possibly damaging Het
Wdr64 A T 1: 175,698,913 I43L probably benign Het
Other mutations in Wsb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01760:Wsb1 APN 11 79242041 missense probably damaging 1.00
IGL02352:Wsb1 APN 11 79251012 missense probably damaging 1.00
IGL02359:Wsb1 APN 11 79251012 missense probably damaging 1.00
IGL03218:Wsb1 APN 11 79248498 missense probably damaging 0.97
R0488:Wsb1 UTSW 11 79244500 missense probably damaging 1.00
R1051:Wsb1 UTSW 11 79246233 missense probably damaging 1.00
R1612:Wsb1 UTSW 11 79248585 missense probably benign 0.31
R2202:Wsb1 UTSW 11 79240386 missense probably benign
R4782:Wsb1 UTSW 11 79240373 missense probably benign 0.44
R4805:Wsb1 UTSW 11 79240391 missense possibly damaging 0.95
R4932:Wsb1 UTSW 11 79251000 missense probably damaging 0.96
R5458:Wsb1 UTSW 11 79248436 missense probably damaging 1.00
R6032:Wsb1 UTSW 11 79240199 unclassified probably benign
R6032:Wsb1 UTSW 11 79240199 unclassified probably benign
R6140:Wsb1 UTSW 11 79241618 missense probably damaging 0.98
R6192:Wsb1 UTSW 11 79248510 missense possibly damaging 0.94
R6498:Wsb1 UTSW 11 79248489 missense probably damaging 1.00
R6545:Wsb1 UTSW 11 79251055 missense probably damaging 1.00
R6608:Wsb1 UTSW 11 79240362 missense probably benign 0.30
R7142:Wsb1 UTSW 11 79250988 missense probably benign 0.01
R7339:Wsb1 UTSW 11 79240358 missense probably damaging 0.97
R7361:Wsb1 UTSW 11 79240797 critical splice acceptor site probably null
R8338:Wsb1 UTSW 11 79246277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCATTCAATATATAGCAGCAG -3'
(R):5'- TCTACAGCTGTAGGGACATAGGAC -3'

Sequencing Primer
(F):5'- GCAGCAGCTCATGTCTAAATATATAC -3'
(R):5'- CATAGGACAAGTGTAGTTGTGTAACC -3'
Posted On2014-11-12