Incidental Mutation 'R2449:Lhx1'
ID248946
Institutional Source Beutler Lab
Gene Symbol Lhx1
Ensembl Gene ENSMUSG00000018698
Gene NameLIM homeobox protein 1
SynonymsLim1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2449 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location84518284-84525535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84521738 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 119 (R119C)
Ref Sequence ENSEMBL: ENSMUSP00000138899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018842] [ENSMUST00000092827] [ENSMUST00000184646]
Predicted Effect probably damaging
Transcript: ENSMUST00000018842
AA Change: R210C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018842
Gene: ENSMUSG00000018698
AA Change: R210C

DomainStartEndE-ValueType
LIM 3 54 5.51e-17 SMART
LIM 62 117 4.24e-18 SMART
low complexity region 137 156 N/A INTRINSIC
HOX 180 242 1.33e-22 SMART
low complexity region 315 327 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092827
SMART Domains Protein: ENSMUSP00000090503
Gene: ENSMUSG00000018698

DomainStartEndE-ValueType
LIM 18 73 4.24e-18 SMART
low complexity region 93 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126072
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128121
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176503
SMART Domains Protein: ENSMUSP00000135334
Gene: ENSMUSG00000018698

DomainStartEndE-ValueType
Pfam:Homeobox 1 17 5.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000184646
AA Change: R119C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138899
Gene: ENSMUSG00000018698
AA Change: R119C

DomainStartEndE-ValueType
low complexity region 46 65 N/A INTRINSIC
HOX 89 151 6.8e-25 SMART
low complexity region 224 236 N/A INTRINSIC
low complexity region 258 276 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor important for the development of the renal and urogenital systems. This gene is a candidate for Mayer-Rokitansky-Kuster-Hauser syndrome, a disorder characterized by anomalies in the female genital tract. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted null mutations are small, fail to develop head structures anterior to rhombomere 3 in the hindbrain, lack kidneys and gonads, and show aberrant trajectories of limb motor axons. Most mutants die around embryonic day 10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Cd83 A T 13: 43,797,656 T95S probably damaging Het
Cdc27 T C 11: 104,505,638 D819G probably benign Het
Hey2 A T 10: 30,840,446 I64K possibly damaging Het
Il10rb A G 16: 91,411,903 H67R probably benign Het
Itgav T A 2: 83,768,750 probably null Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr527 A T 7: 140,336,432 Q190L probably benign Het
Siglec1 T C 2: 131,078,725 T720A probably benign Het
Sycp1 T C 3: 102,925,206 I215V probably benign Het
Trim63 A G 4: 134,323,107 E234G probably damaging Het
Vmn2r56 C T 7: 12,694,155 S728N possibly damaging Het
Wdr64 A T 1: 175,698,913 I43L probably benign Het
Wsb1 T C 11: 79,240,352 K406R probably benign Het
Other mutations in Lhx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:Lhx1 APN 11 84519652 missense probably damaging 0.97
R1346:Lhx1 UTSW 11 84522079 missense possibly damaging 0.55
R1565:Lhx1 UTSW 11 84519821 missense probably benign 0.00
R1806:Lhx1 UTSW 11 84524141 missense probably damaging 1.00
R2148:Lhx1 UTSW 11 84519821 missense probably benign 0.00
R3721:Lhx1 UTSW 11 84521828 missense probably damaging 1.00
R3793:Lhx1 UTSW 11 84521900 missense probably benign 0.01
R4940:Lhx1 UTSW 11 84519909 nonsense probably null
R5178:Lhx1 UTSW 11 84520388 missense possibly damaging 0.69
R5877:Lhx1 UTSW 11 84522239 missense probably damaging 1.00
R6366:Lhx1 UTSW 11 84522208 missense probably damaging 1.00
R6551:Lhx1 UTSW 11 84521913 missense probably benign 0.23
R7060:Lhx1 UTSW 11 84520282 critical splice donor site probably null
R7106:Lhx1 UTSW 11 84522077 missense probably benign 0.00
R7133:Lhx1 UTSW 11 84519920 missense probably benign 0.00
R7161:Lhx1 UTSW 11 84519872 missense probably damaging 1.00
R7290:Lhx1 UTSW 11 84521877 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TAAGCCACTACCAGCTCTGTG -3'
(R):5'- AGGACTCTGAAAGTGCCAACG -3'

Sequencing Primer
(F):5'- ACTACCAGCTCTGTGGGTGTTTTC -3'
(R):5'- TCTGAAAGTGCCAACGTCTCAG -3'
Posted On2014-11-12