Mutagenetix > Incidental Mutation

Incidental Mutation 'R2449:Lhx1'

248946

Institutional Source

Beutler Lab

Gene Symbol

Lhx1

Ensembl Gene

ENSMUSG00000018698

Gene Name

LIM homeobox protein 1

Synonyms

Lim1

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2449 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

84409110-84416361 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 84412564 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 119 (R119C)

Ref Sequence

ENSEMBL: ENSMUSP00000138899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018842] [ENSMUST00000092827] [ENSMUST00000184646]

AlphaFold

P63006

Predicted Effect

probably damaging
Transcript: ENSMUST00000018842
AA Change: R210C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018842
Gene: ENSMUSG00000018698
AA Change: R210C

Domain	Start	End	E-Value	Type
LIM	3	54	5.51e-17	SMART
LIM	62	117	4.24e-18	SMART
low complexity region	137	156	N/A	INTRINSIC
HOX	180	242	1.33e-22	SMART
low complexity region	315	327	N/A	INTRINSIC
low complexity region	349	367	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000092827

SMART Domains

Protein: ENSMUSP00000090503
Gene: ENSMUSG00000018698

Domain	Start	End	E-Value	Type
LIM	18	73	4.24e-18	SMART
low complexity region	93	112	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126072

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128121

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134800

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176503

SMART Domains

Protein: ENSMUSP00000135334
Gene: ENSMUSG00000018698

Domain	Start	End	E-Value	Type
Pfam:Homeobox	1	17	5.3e-6	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000184646
AA Change: R119C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138899
Gene: ENSMUSG00000018698
AA Change: R119C

Domain	Start	End	E-Value	Type
low complexity region	46	65	N/A	INTRINSIC
HOX	89	151	6.8e-25	SMART
low complexity region	224	236	N/A	INTRINSIC
low complexity region	258	276	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large protein family which contains the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor important for the development of the renal and urogenital systems. This gene is a candidate for Mayer-Rokitansky-Kuster-Hauser syndrome, a disorder characterized by anomalies in the female genital tract. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted null mutations are small, fail to develop head structures anterior to rhombomere 3 in the hindbrain, lack kidneys and gonads, and show aberrant trajectories of limb motor axons. Most mutants die around embryonic day 10. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700049A03Rik	G	T	12: 71,211,320 (GRCm39)	E685*	probably null	Het
2700049A03Rik	A	T	12: 71,211,321 (GRCm39)	E685V	possibly damaging	Het
Cd83	A	T	13: 43,951,132 (GRCm39)	T95S	probably damaging	Het
Cdc27	T	C	11: 104,396,464 (GRCm39)	D819G	probably benign	Het
Hey2	A	T	10: 30,716,442 (GRCm39)	I64K	possibly damaging	Het
Il10rb	A	G	16: 91,208,791 (GRCm39)	H67R	probably benign	Het
Itgav	T	A	2: 83,599,094 (GRCm39)		probably null	Het
Ltbp3	G	A	19: 5,804,050 (GRCm39)	R854Q	probably benign	Het
Obscn	T	C	11: 59,022,472 (GRCm39)	R758G	possibly damaging	Het
Or12j2	A	T	7: 139,916,345 (GRCm39)	Q190L	probably benign	Het
Siglec1	T	C	2: 130,920,645 (GRCm39)	T720A	probably benign	Het
Sycp1	T	C	3: 102,832,522 (GRCm39)	I215V	probably benign	Het
Trim63	A	G	4: 134,050,418 (GRCm39)	E234G	probably damaging	Het
Vmn2r56	C	T	7: 12,428,082 (GRCm39)	S728N	possibly damaging	Het
Wdr64	A	T	1: 175,526,479 (GRCm39)	I43L	probably benign	Het
Wsb1	T	C	11: 79,131,178 (GRCm39)	K406R	probably benign	Het

Other mutations in Lhx1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00757:Lhx1	APN	11	84,410,478 (GRCm39)	missense	probably damaging	0.97
R1346:Lhx1	UTSW	11	84,412,905 (GRCm39)	missense	possibly damaging	0.55
R1565:Lhx1	UTSW	11	84,410,647 (GRCm39)	missense	probably benign	0.00
R1806:Lhx1	UTSW	11	84,414,967 (GRCm39)	missense	probably damaging	1.00
R2148:Lhx1	UTSW	11	84,410,647 (GRCm39)	missense	probably benign	0.00
R3721:Lhx1	UTSW	11	84,412,654 (GRCm39)	missense	probably damaging	1.00
R3793:Lhx1	UTSW	11	84,412,726 (GRCm39)	missense	probably benign	0.01
R4940:Lhx1	UTSW	11	84,410,735 (GRCm39)	nonsense	probably null
R5178:Lhx1	UTSW	11	84,411,214 (GRCm39)	missense	possibly damaging	0.69
R5877:Lhx1	UTSW	11	84,413,065 (GRCm39)	missense	probably damaging	1.00
R6366:Lhx1	UTSW	11	84,413,034 (GRCm39)	missense	probably damaging	1.00
R6551:Lhx1	UTSW	11	84,412,739 (GRCm39)	missense	probably benign	0.23
R7060:Lhx1	UTSW	11	84,411,108 (GRCm39)	critical splice donor site	probably null
R7106:Lhx1	UTSW	11	84,412,903 (GRCm39)	missense	probably benign	0.00
R7133:Lhx1	UTSW	11	84,410,746 (GRCm39)	missense	probably benign	0.00
R7161:Lhx1	UTSW	11	84,410,698 (GRCm39)	missense	probably damaging	1.00
R7290:Lhx1	UTSW	11	84,412,703 (GRCm39)	missense	probably damaging	0.96
R8843:Lhx1	UTSW	11	84,410,455 (GRCm39)	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TAAGCCACTACCAGCTCTGTG -3'
(R):5'- AGGACTCTGAAAGTGCCAACG -3'

Sequencing Primer
(F):5'- ACTACCAGCTCTGTGGGTGTTTTC -3'
(R):5'- TCTGAAAGTGCCAACGTCTCAG -3'

Posted On

2014-11-12