Incidental Mutation 'R2449:Cd83'
ID248950
Institutional Source Beutler Lab
Gene Symbol Cd83
Ensembl Gene ENSMUSG00000015396
Gene NameCD83 antigen
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2449 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location43784775-43803132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43797656 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 95 (T95S)
Ref Sequence ENSEMBL: ENSMUSP00000015540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015540]
Predicted Effect probably damaging
Transcript: ENSMUST00000015540
AA Change: T95S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000015540
Gene: ENSMUSG00000015396
AA Change: T95S

DomainStartEndE-ValueType
IG 22 118 5.37e-4 SMART
transmembrane domain 137 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221359
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a single-pass type I membrane protein and member of the immunoglobulin superfamily of receptors. The encoded protein may be involved in the regulation of antigen presentation. A soluble form of this protein can bind to dendritic cells and inhibit their maturation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice lacking this gene develop, thrive, and reproduce normally, but exhibit defects in T cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Cdc27 T C 11: 104,505,638 D819G probably benign Het
Hey2 A T 10: 30,840,446 I64K possibly damaging Het
Il10rb A G 16: 91,411,903 H67R probably benign Het
Itgav T A 2: 83,768,750 probably null Het
Lhx1 G A 11: 84,521,738 R119C probably damaging Het
Ltbp3 G A 19: 5,754,022 R854Q probably benign Het
Obscn T C 11: 59,131,646 R758G possibly damaging Het
Olfr527 A T 7: 140,336,432 Q190L probably benign Het
Siglec1 T C 2: 131,078,725 T720A probably benign Het
Sycp1 T C 3: 102,925,206 I215V probably benign Het
Trim63 A G 4: 134,323,107 E234G probably damaging Het
Vmn2r56 C T 7: 12,694,155 S728N possibly damaging Het
Wdr64 A T 1: 175,698,913 I43L probably benign Het
Wsb1 T C 11: 79,240,352 K406R probably benign Het
Other mutations in Cd83
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01665:Cd83 APN 13 43801677 missense probably benign 0.41
IGL02802:Cd83 UTSW 13 43799671 missense probably null 1.00
R0646:Cd83 UTSW 13 43797533 missense probably benign 0.03
R7686:Cd83 UTSW 13 43785372 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTAAAGCCCTCACGCCAG -3'
(R):5'- AATGTTGGGCAAAAGTCAGTGC -3'

Sequencing Primer
(F):5'- ACGCCAGTCTGTCAGTAATTG -3'
(R):5'- GGAATTCATTTCCGGCCACAGATG -3'
Posted On2014-11-12