Incidental Mutation 'R0305:Vmn2r57'
ID24896
Institutional Source Beutler Lab
Gene Symbol Vmn2r57
Ensembl Gene ENSMUSG00000066537
Gene Namevomeronasal 2, receptor 57
SynonymsEG269902
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location41399732-41448641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41427543 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 400 (I400V)
Ref Sequence ENSEMBL: ENSMUSP00000125817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094532] [ENSMUST00000165029]
Predicted Effect probably benign
Transcript: ENSMUST00000094532
Predicted Effect probably benign
Transcript: ENSMUST00000165029
AA Change: I400V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000125817
Gene: ENSMUSG00000066537
AA Change: I400V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 471 1.4e-44 PFAM
Pfam:NCD3G 514 567 2.7e-23 PFAM
Pfam:7tm_3 600 835 1.8e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Olfr507 G A 7: 108,622,585 V258I probably benign Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Vmn2r57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Vmn2r57 APN 7 41428785 missense probably benign
IGL01108:Vmn2r57 APN 7 41427584 missense probably benign 0.01
IGL01112:Vmn2r57 APN 7 41425043 missense probably damaging 1.00
IGL01516:Vmn2r57 APN 7 41399946 missense probably damaging 1.00
IGL01880:Vmn2r57 APN 7 41400195 missense possibly damaging 0.73
IGL02117:Vmn2r57 APN 7 41400450 missense probably benign 0.00
IGL02500:Vmn2r57 APN 7 41428226 missense probably benign
IGL02801:Vmn2r57 APN 7 41448632 missense probably benign 0.13
IGL02993:Vmn2r57 APN 7 41428074 missense probably benign 0.04
IGL02996:Vmn2r57 APN 7 41399741 missense probably benign 0.02
R0008:Vmn2r57 UTSW 7 41400652 missense probably damaging 1.00
R0032:Vmn2r57 UTSW 7 41399733 splice site probably null
R0469:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0510:Vmn2r57 UTSW 7 41427792 missense possibly damaging 0.58
R0847:Vmn2r57 UTSW 7 41428801 missense probably benign 0.00
R1025:Vmn2r57 UTSW 7 41427804 missense probably benign 0.24
R1081:Vmn2r57 UTSW 7 41428211 missense possibly damaging 0.47
R1479:Vmn2r57 UTSW 7 41427830 missense possibly damaging 0.45
R1579:Vmn2r57 UTSW 7 41400124 missense probably benign 0.38
R1764:Vmn2r57 UTSW 7 41400643 missense probably damaging 1.00
R1848:Vmn2r57 UTSW 7 41428107 missense probably damaging 1.00
R2006:Vmn2r57 UTSW 7 41448577 missense probably benign 0.00
R2197:Vmn2r57 UTSW 7 41428825 critical splice acceptor site probably null
R2242:Vmn2r57 UTSW 7 41428074 missense probably benign 0.00
R2394:Vmn2r57 UTSW 7 41400195 missense possibly damaging 0.73
R3937:Vmn2r57 UTSW 7 41428130 missense probably damaging 0.97
R4193:Vmn2r57 UTSW 7 41428239 missense probably benign
R4423:Vmn2r57 UTSW 7 41426640 missense probably damaging 1.00
R4865:Vmn2r57 UTSW 7 41400468 missense probably damaging 1.00
R4947:Vmn2r57 UTSW 7 41400495 missense probably damaging 1.00
R5042:Vmn2r57 UTSW 7 41428662 missense probably benign 0.06
R5084:Vmn2r57 UTSW 7 41426550 critical splice donor site probably null
R5177:Vmn2r57 UTSW 7 41400240 missense probably benign 0.31
R5192:Vmn2r57 UTSW 7 41427939 missense probably damaging 0.96
R5289:Vmn2r57 UTSW 7 41399974 missense probably damaging 0.99
R5745:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R6051:Vmn2r57 UTSW 7 41448472 missense probably benign 0.00
R6155:Vmn2r57 UTSW 7 41428690 missense probably benign 0.14
R6248:Vmn2r57 UTSW 7 41399860 missense probably benign
R6381:Vmn2r57 UTSW 7 41428818 missense probably benign 0.08
R7019:Vmn2r57 UTSW 7 41428665 missense probably damaging 1.00
R7126:Vmn2r57 UTSW 7 41399794 missense possibly damaging 0.93
R7146:Vmn2r57 UTSW 7 41448471 missense possibly damaging 0.51
R7215:Vmn2r57 UTSW 7 41400286 missense probably benign 0.00
R7432:Vmn2r57 UTSW 7 41426724 missense probably benign 0.01
R7633:Vmn2r57 UTSW 7 41425089 missense possibly damaging 0.76
X0026:Vmn2r57 UTSW 7 41428125 missense probably benign 0.03
X0026:Vmn2r57 UTSW 7 41428561 missense possibly damaging 0.91
X0065:Vmn2r57 UTSW 7 41427971 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CCATGCATAAAATGGAGGCCCTCG -3'
(R):5'- CGACACATTGCACAACTGTTAGTGAC -3'

Sequencing Primer
(F):5'- TTGCATTGGACATCAGAGTGAAAC -3'
(R):5'- AAAGTCTGGGTCTTGAACTCTC -3'
Posted On2013-04-16