Incidental Mutation 'R2415:Limch1'
ID 248963
Institutional Source Beutler Lab
Gene Symbol Limch1
Ensembl Gene ENSMUSG00000037736
Gene Name LIM and calponin homology domains 1
Synonyms 3732412D22Rik
MMRRC Submission 040379-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.121) question?
Stock # R2415 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 66903232-67214502 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67131977 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 147 (S147P)
Ref Sequence ENSEMBL: ENSMUSP00000114681 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038188] [ENSMUST00000101164] [ENSMUST00000117601] [ENSMUST00000118242] [ENSMUST00000127184] [ENSMUST00000132991]
AlphaFold Q3UH68
Predicted Effect probably benign
Transcript: ENSMUST00000038188
AA Change: S147P

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000043163
Gene: ENSMUSG00000037736
AA Change: S147P

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
coiled coil region 192 241 N/A INTRINSIC
low complexity region 411 430 N/A INTRINSIC
coiled coil region 615 672 N/A INTRINSIC
low complexity region 679 691 N/A INTRINSIC
LIM 830 888 5.08e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101164
AA Change: S303P

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000098723
Gene: ENSMUSG00000037736
AA Change: S303P

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
LIM 986 1044 5.08e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117601
AA Change: S144P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113544
Gene: ENSMUSG00000037736
AA Change: S144P

DomainStartEndE-ValueType
CH 23 124 1e-15 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 348 397 N/A INTRINSIC
low complexity region 567 586 N/A INTRINSIC
coiled coil region 704 752 N/A INTRINSIC
low complexity region 759 771 N/A INTRINSIC
LIM 910 968 2.4e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118242
AA Change: S303P

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112732
Gene: ENSMUSG00000037736
AA Change: S303P

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
low complexity region 285 296 N/A INTRINSIC
coiled coil region 336 385 N/A INTRINSIC
low complexity region 555 574 N/A INTRINSIC
coiled coil region 782 839 N/A INTRINSIC
low complexity region 846 858 N/A INTRINSIC
LIM 997 1055 5.08e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000119854
AA Change: S31P
SMART Domains Protein: ENSMUSP00000112651
Gene: ENSMUSG00000037736
AA Change: S31P

DomainStartEndE-ValueType
CH 23 124 2.09e-13 SMART
low complexity region 197 213 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Pfam:DUF4757 250 418 5.2e-66 PFAM
low complexity region 567 586 N/A INTRINSIC
coiled coil region 771 828 N/A INTRINSIC
low complexity region 835 847 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
LIM 1012 1070 5.08e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127184
AA Change: S147P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000114681
Gene: ENSMUSG00000037736
AA Change: S147P

DomainStartEndE-ValueType
low complexity region 41 57 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 129 140 N/A INTRINSIC
coiled coil region 180 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132991
AA Change: S156P

PolyPhen 2 Score 0.064 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000123337
Gene: ENSMUSG00000037736
AA Change: S156P

DomainStartEndE-ValueType
low complexity region 50 66 N/A INTRINSIC
low complexity region 76 89 N/A INTRINSIC
Pfam:DUF4757 103 269 2.6e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201322
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201852
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140428
Meta Mutation Damage Score 0.1836 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano6 A T 15: 95,860,161 (GRCm39) N761I probably damaging Het
Atad5 T C 11: 79,985,077 (GRCm39) S55P probably damaging Het
Cul9 T A 17: 46,854,364 (GRCm39) T113S probably benign Het
Ddx56 G A 11: 6,211,727 (GRCm39) probably benign Het
Dnttip2 T C 3: 122,070,186 (GRCm39) V467A probably damaging Het
Efhb A T 17: 53,770,124 (GRCm39) F62I probably benign Het
Efl1 T A 7: 82,347,175 (GRCm39) M567K probably damaging Het
Fbxw21 G T 9: 108,985,469 (GRCm39) A103E possibly damaging Het
Flnb T A 14: 7,929,932 (GRCm38) S2021T probably benign Het
Gabpa T C 16: 84,641,256 (GRCm39) probably null Het
Grid1 A T 14: 35,172,326 (GRCm39) I611F possibly damaging Het
Hdac1 A C 4: 129,416,754 (GRCm39) probably null Het
Kcnk5 T C 14: 20,191,880 (GRCm39) E427G possibly damaging Het
Kcnu1 A T 8: 26,400,906 (GRCm39) T685S probably benign Het
Khdc1b A G 1: 21,454,534 (GRCm39) D79G probably benign Het
Ky G T 9: 102,419,090 (GRCm39) G366W probably damaging Het
Mroh1 A G 15: 76,305,411 (GRCm39) K405E probably damaging Het
Myo15b T G 11: 115,770,390 (GRCm39) F67V probably benign Het
Nlrp4c A G 7: 6,069,047 (GRCm39) D316G probably damaging Het
Nudt12 A G 17: 59,313,603 (GRCm39) V325A probably damaging Het
Pdia4 G T 6: 47,783,490 (GRCm39) D184E probably benign Het
Per3 A C 4: 151,097,147 (GRCm39) F793V possibly damaging Het
Pla1a T A 16: 38,228,112 (GRCm39) Y255F possibly damaging Het
Rxfp1 A G 3: 79,570,626 (GRCm39) S269P probably benign Het
S100pbp A T 4: 129,075,614 (GRCm39) V118D possibly damaging Het
Sec24b A T 3: 129,789,729 (GRCm39) I764N probably benign Het
Sh3bp1 C T 15: 78,785,361 (GRCm39) probably benign Het
Surf6 C T 2: 26,782,274 (GRCm39) R351H probably damaging Het
Tspan15 A G 10: 62,037,570 (GRCm39) I115T probably benign Het
Vmn2r73 T C 7: 85,521,431 (GRCm39) Y179C probably damaging Het
Zfp750 T C 11: 121,403,305 (GRCm39) D481G probably benign Het
Other mutations in Limch1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Limch1 APN 5 67,111,022 (GRCm39) missense probably damaging 0.99
IGL00644:Limch1 APN 5 67,173,895 (GRCm39) missense probably benign 0.01
IGL00705:Limch1 APN 5 67,150,496 (GRCm39) nonsense probably null
IGL01154:Limch1 APN 5 66,903,301 (GRCm39) nonsense probably null 0.00
IGL01865:Limch1 APN 5 67,131,923 (GRCm39) nonsense probably null
IGL02529:Limch1 APN 5 67,159,956 (GRCm39) missense possibly damaging 0.89
IGL03171:Limch1 APN 5 67,191,537 (GRCm39) missense possibly damaging 0.80
IGL03308:Limch1 APN 5 67,159,901 (GRCm39) missense possibly damaging 0.92
IGL03396:Limch1 APN 5 67,111,016 (GRCm39) missense probably damaging 1.00
R0067:Limch1 UTSW 5 67,131,965 (GRCm39) missense probably damaging 0.99
R0067:Limch1 UTSW 5 67,131,965 (GRCm39) missense probably damaging 0.99
R0114:Limch1 UTSW 5 67,193,427 (GRCm39) intron probably benign
R0129:Limch1 UTSW 5 67,116,933 (GRCm39) missense probably damaging 0.96
R0193:Limch1 UTSW 5 67,184,882 (GRCm39) missense probably damaging 1.00
R0194:Limch1 UTSW 5 67,156,616 (GRCm39) missense probably benign 0.05
R0367:Limch1 UTSW 5 67,015,297 (GRCm39) critical splice donor site probably null
R0558:Limch1 UTSW 5 67,126,498 (GRCm39) missense probably damaging 1.00
R0927:Limch1 UTSW 5 67,154,576 (GRCm39) missense probably damaging 1.00
R1190:Limch1 UTSW 5 67,126,540 (GRCm39) missense probably damaging 1.00
R1316:Limch1 UTSW 5 67,156,586 (GRCm39) missense probably damaging 1.00
R1469:Limch1 UTSW 5 67,039,323 (GRCm39) splice site probably benign
R1647:Limch1 UTSW 5 67,156,599 (GRCm39) missense probably damaging 1.00
R1648:Limch1 UTSW 5 67,156,599 (GRCm39) missense probably damaging 1.00
R1944:Limch1 UTSW 5 67,156,442 (GRCm39) missense probably damaging 1.00
R2103:Limch1 UTSW 5 67,156,072 (GRCm39) missense probably benign 0.05
R2126:Limch1 UTSW 5 67,187,103 (GRCm39) missense probably damaging 1.00
R2248:Limch1 UTSW 5 67,201,742 (GRCm39) missense probably damaging 1.00
R3762:Limch1 UTSW 5 67,186,183 (GRCm39) missense probably damaging 1.00
R3797:Limch1 UTSW 5 67,126,422 (GRCm39) missense probably damaging 1.00
R4659:Limch1 UTSW 5 67,184,900 (GRCm39) missense probably damaging 1.00
R4773:Limch1 UTSW 5 67,184,850 (GRCm39) missense probably damaging 0.99
R4876:Limch1 UTSW 5 67,039,270 (GRCm39) missense possibly damaging 0.64
R5062:Limch1 UTSW 5 67,126,578 (GRCm39) missense probably damaging 1.00
R5191:Limch1 UTSW 5 67,184,904 (GRCm39) missense probably damaging 1.00
R5202:Limch1 UTSW 5 67,150,516 (GRCm39) missense probably damaging 1.00
R5335:Limch1 UTSW 5 67,039,300 (GRCm39) missense probably damaging 1.00
R5436:Limch1 UTSW 5 67,131,909 (GRCm39) missense possibly damaging 0.72
R5994:Limch1 UTSW 5 67,131,965 (GRCm39) missense probably damaging 1.00
R6049:Limch1 UTSW 5 67,188,203 (GRCm39) missense probably benign 0.32
R6228:Limch1 UTSW 5 67,173,845 (GRCm39) missense probably damaging 1.00
R6547:Limch1 UTSW 5 67,186,117 (GRCm39) missense probably damaging 1.00
R6600:Limch1 UTSW 5 66,903,281 (GRCm39) missense probably benign
R6888:Limch1 UTSW 5 67,179,269 (GRCm39) missense probably benign 0.21
R7111:Limch1 UTSW 5 67,182,519 (GRCm39) splice site probably null
R7132:Limch1 UTSW 5 67,111,028 (GRCm39) missense probably damaging 1.00
R7144:Limch1 UTSW 5 67,175,001 (GRCm39) missense probably benign 0.10
R7302:Limch1 UTSW 5 67,116,942 (GRCm39) missense probably benign 0.02
R7341:Limch1 UTSW 5 67,191,545 (GRCm39) missense probably benign 0.06
R7491:Limch1 UTSW 5 67,211,580 (GRCm39) missense probably damaging 0.99
R8079:Limch1 UTSW 5 67,204,096 (GRCm39) missense possibly damaging 0.73
R8229:Limch1 UTSW 5 67,186,138 (GRCm39) missense probably damaging 1.00
R8348:Limch1 UTSW 5 67,159,825 (GRCm39) missense probably damaging 0.98
R8395:Limch1 UTSW 5 67,126,394 (GRCm39) missense probably damaging 0.96
R8416:Limch1 UTSW 5 67,156,649 (GRCm39) missense probably benign
R8448:Limch1 UTSW 5 67,159,825 (GRCm39) missense probably damaging 0.98
R8477:Limch1 UTSW 5 67,131,908 (GRCm39) missense probably benign 0.01
R8924:Limch1 UTSW 5 67,190,475 (GRCm39) missense probably benign 0.01
R9080:Limch1 UTSW 5 67,174,992 (GRCm39) missense probably benign 0.00
R9619:Limch1 UTSW 5 67,015,284 (GRCm39) missense probably damaging 1.00
R9681:Limch1 UTSW 5 67,126,422 (GRCm39) missense probably damaging 1.00
R9715:Limch1 UTSW 5 67,156,360 (GRCm39) missense probably damaging 1.00
X0022:Limch1 UTSW 5 67,179,295 (GRCm39) missense probably benign 0.00
X0027:Limch1 UTSW 5 67,159,963 (GRCm39) missense probably damaging 1.00
Z1177:Limch1 UTSW 5 67,186,142 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCGGAAGTTGCCAGATGTG -3'
(R):5'- CAACAGAACTGGCCTCAGAG -3'

Sequencing Primer
(F):5'- TGTGAAGAAAGATGATATGTCCGCAC -3'
(R):5'- GCTCCTCAGCAAAGTATATGTTG -3'
Posted On 2014-11-12