Incidental Mutation 'R2415:Efl1'
ID248968
Institutional Source Beutler Lab
Gene Symbol Efl1
Ensembl Gene ENSMUSG00000038563
Gene Nameelongation factor like GPTase 1
Synonyms6030468D11Rik, 4932434J20Rik, D7Ertd791e, Eftud1
MMRRC Submission 040379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.247) question?
Stock #R2415 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location82648614-82777852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 82697967 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 567 (M567K)
Ref Sequence ENSEMBL: ENSMUSP00000137061 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039881] [ENSMUST00000179489]
Predicted Effect probably damaging
Transcript: ENSMUST00000039881
AA Change: M567K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046046
Gene: ENSMUSG00000038563
AA Change: M567K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 365 7.4e-62 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:EFG_II 614 687 4.3e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125245
Predicted Effect probably damaging
Transcript: ENSMUST00000179489
AA Change: M567K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137061
Gene: ENSMUSG00000038563
AA Change: M567K

DomainStartEndE-ValueType
Pfam:GTP_EFTU 17 364 8.7e-58 PFAM
low complexity region 435 451 N/A INTRINSIC
Pfam:GTP_EFTU_D2 504 599 1e-7 PFAM
Pfam:EFG_II 614 687 1.8e-9 PFAM
EFG_C 986 1075 1.03e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209142
Meta Mutation Damage Score 0.9442 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit late-onset and progressive gait abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano6 A T 15: 95,962,280 N761I probably damaging Het
Atad5 T C 11: 80,094,251 S55P probably damaging Het
Cul9 T A 17: 46,543,438 T113S probably benign Het
Ddx56 G A 11: 6,261,727 probably benign Het
Dnttip2 T C 3: 122,276,537 V467A probably damaging Het
Efhb A T 17: 53,463,096 F62I probably benign Het
Fbxw21 G T 9: 109,156,401 A103E possibly damaging Het
Flnb T A 14: 7,929,932 S2021T probably benign Het
Gabpa T C 16: 84,844,368 probably null Het
Grid1 A T 14: 35,450,369 I611F possibly damaging Het
Hdac1 A C 4: 129,522,961 probably null Het
Kcnk5 T C 14: 20,141,812 E427G possibly damaging Het
Kcnu1 A T 8: 25,910,878 T685S probably benign Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Ky G T 9: 102,541,891 G366W probably damaging Het
Limch1 T C 5: 66,974,634 S147P probably damaging Het
Mroh1 A G 15: 76,421,211 K405E probably damaging Het
Myo15b T G 11: 115,879,564 F67V probably benign Het
Nlrp4c A G 7: 6,066,048 D316G probably damaging Het
Nudt12 A G 17: 59,006,608 V325A probably damaging Het
Pdia4 G T 6: 47,806,556 D184E probably benign Het
Per3 A C 4: 151,012,690 F793V possibly damaging Het
Pla1a T A 16: 38,407,750 Y255F possibly damaging Het
Rxfp1 A G 3: 79,663,319 S269P probably benign Het
S100pbp A T 4: 129,181,821 V118D possibly damaging Het
Sec24b A T 3: 129,996,080 I764N probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Surf6 C T 2: 26,892,262 R351H probably damaging Het
Tspan15 A G 10: 62,201,791 I115T probably benign Het
Vmn2r73 T C 7: 85,872,223 Y179C probably damaging Het
Zfp750 T C 11: 121,512,479 D481G probably benign Het
Other mutations in Efl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00541:Efl1 APN 7 82658111 missense probably damaging 1.00
IGL00696:Efl1 APN 7 82651872 splice site probably benign
IGL01344:Efl1 APN 7 82681480 splice site probably benign
IGL01871:Efl1 APN 7 82763319 missense possibly damaging 0.64
IGL01941:Efl1 APN 7 82697976 missense probably benign 0.17
IGL02104:Efl1 APN 7 82658055 critical splice acceptor site probably null
IGL02150:Efl1 APN 7 82686691 missense probably benign
IGL02484:Efl1 APN 7 82683039 missense probably damaging 0.98
IGL03140:Efl1 APN 7 82692881 missense probably benign 0.00
IGL03188:Efl1 APN 7 82671701 missense probably damaging 1.00
IGL03014:Efl1 UTSW 7 82651886 missense probably damaging 1.00
PIT4469001:Efl1 UTSW 7 82658165 missense probably benign 0.14
R0148:Efl1 UTSW 7 82671670 missense probably damaging 1.00
R0226:Efl1 UTSW 7 82693011 splice site probably benign
R0638:Efl1 UTSW 7 82651887 missense probably damaging 1.00
R0684:Efl1 UTSW 7 82651886 missense probably damaging 1.00
R1018:Efl1 UTSW 7 82763013 missense possibly damaging 0.94
R1290:Efl1 UTSW 7 82671728 missense probably damaging 1.00
R1720:Efl1 UTSW 7 82683721 missense possibly damaging 0.50
R1933:Efl1 UTSW 7 82763117 nonsense probably null
R1973:Efl1 UTSW 7 82762877 missense probably damaging 1.00
R2016:Efl1 UTSW 7 82753709 missense probably damaging 1.00
R2124:Efl1 UTSW 7 82692913 missense probably damaging 1.00
R2290:Efl1 UTSW 7 82777670 missense probably damaging 1.00
R3545:Efl1 UTSW 7 82762810 missense probably benign 0.00
R3688:Efl1 UTSW 7 82762970 missense probably benign 0.00
R4092:Efl1 UTSW 7 82762827 missense probably benign 0.00
R4207:Efl1 UTSW 7 82750816 missense probably damaging 0.98
R4347:Efl1 UTSW 7 82697966 missense probably damaging 1.00
R4425:Efl1 UTSW 7 82763283 missense probably damaging 0.99
R4816:Efl1 UTSW 7 82671719 missense probably damaging 1.00
R4858:Efl1 UTSW 7 82671627 missense probably damaging 1.00
R5077:Efl1 UTSW 7 82658087 missense probably damaging 1.00
R5185:Efl1 UTSW 7 82772499 missense probably damaging 1.00
R5319:Efl1 UTSW 7 82674506 missense probably damaging 1.00
R5771:Efl1 UTSW 7 82692524 missense probably benign 0.26
R5857:Efl1 UTSW 7 82763189 missense probably benign
R5956:Efl1 UTSW 7 82651899 missense probably damaging 1.00
R6433:Efl1 UTSW 7 82674568 missense probably damaging 1.00
R7131:Efl1 UTSW 7 82658064 missense probably damaging 1.00
R7143:Efl1 UTSW 7 82762680 missense probably damaging 1.00
R7312:Efl1 UTSW 7 82681444 missense probably benign 0.10
R7409:Efl1 UTSW 7 82697913 missense probably damaging 0.98
R7422:Efl1 UTSW 7 82681379 missense probably damaging 1.00
R7453:Efl1 UTSW 7 82681467 missense possibly damaging 0.76
R7504:Efl1 UTSW 7 82683049 missense probably damaging 1.00
R7884:Efl1 UTSW 7 82658099 missense probably damaging 1.00
R7969:Efl1 UTSW 7 82692970 missense probably benign 0.03
R8394:Efl1 UTSW 7 82762778 missense probably benign 0.00
R8702:Efl1 UTSW 7 82750790 critical splice acceptor site probably null
R8924:Efl1 UTSW 7 82762953 missense probably benign 0.03
Z1088:Efl1 UTSW 7 82692850 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACCTTTGAGGGTGCTGCAG -3'
(R):5'- TTACTGACTCACAAGGTGGTG -3'

Sequencing Primer
(F):5'- AGGGTGCTGCAGTGCCTC -3'
(R):5'- TTAAGGCTGGAGTGAGCA -3'
Posted On2014-11-12