Incidental Mutation 'R2415:Ky'
ID248971
Institutional Source Beutler Lab
Gene Symbol Ky
Ensembl Gene ENSMUSG00000035606
Gene Namekyphoscoliosis peptidase
SynonymsD9Mgc44e
MMRRC Submission 040379-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R2415 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location102505750-102546239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 102541891 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 366 (G366W)
Ref Sequence ENSEMBL: ENSMUSP00000036032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039390]
Predicted Effect probably damaging
Transcript: ENSMUST00000039390
AA Change: G366W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036032
Gene: ENSMUSG00000035606
AA Change: G366W

DomainStartEndE-ValueType
TGc 217 285 1.9e-14 SMART
Meta Mutation Damage Score 0.3043 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
MGI Phenotype PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe degenerative myopathy involving postural muscles, resulting in thoraco-lumbar kyphoscoliosis with degenerative changes in intervertebral discs. Body weight is reduced and breathing is irregular. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano6 A T 15: 95,962,280 N761I probably damaging Het
Atad5 T C 11: 80,094,251 S55P probably damaging Het
Cul9 T A 17: 46,543,438 T113S probably benign Het
Ddx56 G A 11: 6,261,727 probably benign Het
Dnttip2 T C 3: 122,276,537 V467A probably damaging Het
Efhb A T 17: 53,463,096 F62I probably benign Het
Efl1 T A 7: 82,697,967 M567K probably damaging Het
Fbxw21 G T 9: 109,156,401 A103E possibly damaging Het
Flnb T A 14: 7,929,932 S2021T probably benign Het
Gabpa T C 16: 84,844,368 probably null Het
Grid1 A T 14: 35,450,369 I611F possibly damaging Het
Hdac1 A C 4: 129,522,961 probably null Het
Kcnk5 T C 14: 20,141,812 E427G possibly damaging Het
Kcnu1 A T 8: 25,910,878 T685S probably benign Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Limch1 T C 5: 66,974,634 S147P probably damaging Het
Mroh1 A G 15: 76,421,211 K405E probably damaging Het
Myo15b T G 11: 115,879,564 F67V probably benign Het
Nlrp4c A G 7: 6,066,048 D316G probably damaging Het
Nudt12 A G 17: 59,006,608 V325A probably damaging Het
Pdia4 G T 6: 47,806,556 D184E probably benign Het
Per3 A C 4: 151,012,690 F793V possibly damaging Het
Pla1a T A 16: 38,407,750 Y255F possibly damaging Het
Rxfp1 A G 3: 79,663,319 S269P probably benign Het
S100pbp A T 4: 129,181,821 V118D possibly damaging Het
Sec24b A T 3: 129,996,080 I764N probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Surf6 C T 2: 26,892,262 R351H probably damaging Het
Tspan15 A G 10: 62,201,791 I115T probably benign Het
Vmn2r73 T C 7: 85,872,223 Y179C probably damaging Het
Zfp750 T C 11: 121,512,479 D481G probably benign Het
Other mutations in Ky
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01515:Ky APN 9 102542105 missense probably benign
IGL02197:Ky APN 9 102537786 missense possibly damaging 0.63
PIT4802001:Ky UTSW 9 102537773 missense probably benign 0.00
R0384:Ky UTSW 9 102542090 missense probably benign 0.05
R0620:Ky UTSW 9 102537621 missense probably benign 0.04
R1099:Ky UTSW 9 102537724 missense probably damaging 1.00
R1754:Ky UTSW 9 102541927 missense possibly damaging 0.54
R2075:Ky UTSW 9 102542746 missense probably damaging 0.98
R2322:Ky UTSW 9 102537791 critical splice donor site probably null
R3950:Ky UTSW 9 102542428 nonsense probably null
R4419:Ky UTSW 9 102542710 missense probably damaging 1.00
R4786:Ky UTSW 9 102541987 missense probably benign 0.02
R5261:Ky UTSW 9 102537599 critical splice acceptor site probably null
R5529:Ky UTSW 9 102542075 missense probably benign 0.10
R6857:Ky UTSW 9 102542432 missense probably damaging 1.00
R6931:Ky UTSW 9 102537627 missense probably damaging 1.00
R7205:Ky UTSW 9 102542292 missense probably damaging 1.00
R7211:Ky UTSW 9 102509150 missense probably benign 0.08
R7570:Ky UTSW 9 102542329 missense probably benign 0.00
R7642:Ky UTSW 9 102542270 missense probably benign 0.32
R7644:Ky UTSW 9 102537773 missense probably benign 0.00
R7910:Ky UTSW 9 102541942 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- CCCAGTTATCACAGTTATCAGCTG -3'
(R):5'- AGATTTCAGAGTTGCCCTTGG -3'

Sequencing Primer
(F):5'- TGAGTCAGAAGAATACCGCGTTC -3'
(R):5'- TTGGCGAAGATCTGCAGC -3'
Posted On2014-11-12