Incidental Mutation 'R2415:Tspan15'
ID248973
Institutional Source Beutler Lab
Gene Symbol Tspan15
Ensembl Gene ENSMUSG00000037031
Gene Nametetraspanin 15
Synonyms2700063A19Rik, Tm4sf15
MMRRC Submission 040379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R2415 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62185396-62231251 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 62201791 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 115 (I115T)
Ref Sequence ENSEMBL: ENSMUSP00000047029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047883]
Predicted Effect probably benign
Transcript: ENSMUST00000047883
AA Change: I115T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000047029
Gene: ENSMUSG00000037031
AA Change: I115T

DomainStartEndE-ValueType
Pfam:Tetraspannin 18 259 1.1e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220143
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. The use of alternate polyadenylation sites has been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano6 A T 15: 95,962,280 N761I probably damaging Het
Atad5 T C 11: 80,094,251 S55P probably damaging Het
Cul9 T A 17: 46,543,438 T113S probably benign Het
Ddx56 G A 11: 6,261,727 probably benign Het
Dnttip2 T C 3: 122,276,537 V467A probably damaging Het
Efhb A T 17: 53,463,096 F62I probably benign Het
Efl1 T A 7: 82,697,967 M567K probably damaging Het
Fbxw21 G T 9: 109,156,401 A103E possibly damaging Het
Flnb T A 14: 7,929,932 S2021T probably benign Het
Gabpa T C 16: 84,844,368 probably null Het
Grid1 A T 14: 35,450,369 I611F possibly damaging Het
Hdac1 A C 4: 129,522,961 probably null Het
Kcnk5 T C 14: 20,141,812 E427G possibly damaging Het
Kcnu1 A T 8: 25,910,878 T685S probably benign Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Ky G T 9: 102,541,891 G366W probably damaging Het
Limch1 T C 5: 66,974,634 S147P probably damaging Het
Mroh1 A G 15: 76,421,211 K405E probably damaging Het
Myo15b T G 11: 115,879,564 F67V probably benign Het
Nlrp4c A G 7: 6,066,048 D316G probably damaging Het
Nudt12 A G 17: 59,006,608 V325A probably damaging Het
Pdia4 G T 6: 47,806,556 D184E probably benign Het
Per3 A C 4: 151,012,690 F793V possibly damaging Het
Pla1a T A 16: 38,407,750 Y255F possibly damaging Het
Rxfp1 A G 3: 79,663,319 S269P probably benign Het
S100pbp A T 4: 129,181,821 V118D possibly damaging Het
Sec24b A T 3: 129,996,080 I764N probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Surf6 C T 2: 26,892,262 R351H probably damaging Het
Vmn2r73 T C 7: 85,872,223 Y179C probably damaging Het
Zfp750 T C 11: 121,512,479 D481G probably benign Het
Other mutations in Tspan15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02145:Tspan15 APN 10 62193972 splice site probably benign
PIT1430001:Tspan15 UTSW 10 62188120 missense probably damaging 0.98
R0071:Tspan15 UTSW 10 62203070 splice site probably benign
R0071:Tspan15 UTSW 10 62203070 splice site probably benign
R0310:Tspan15 UTSW 10 62188093 missense probably benign 0.01
R4152:Tspan15 UTSW 10 62189842 missense possibly damaging 0.87
R4766:Tspan15 UTSW 10 62191544 missense probably benign 0.00
R7446:Tspan15 UTSW 10 62193955 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCTAGCCACTTAGCATGATG -3'
(R):5'- AGTCTCTAGCTTCAAGGCTTC -3'

Sequencing Primer
(F):5'- GCTATCCTAGTTTACCCAACC -3'
(R):5'- TTCTCTAGCACAGCCCTAGGAG -3'
Posted On2014-11-12