Incidental Mutation 'R0305:Olfr507'
ID24898
Institutional Source Beutler Lab
Gene Symbol Olfr507
Ensembl Gene ENSMUSG00000061000
Gene Nameolfactory receptor 507
SynonymsGA_x6K02T2PBJ9-10951546-10952496, MOR204-7
MMRRC Submission 038516-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R0305 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108621814-108622764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108622585 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 258 (V258I)
Ref Sequence ENSEMBL: ENSMUSP00000078926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080014]
Predicted Effect probably benign
Transcript: ENSMUST00000080014
AA Change: V258I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000078926
Gene: ENSMUSG00000061000
AA Change: V258I

DomainStartEndE-ValueType
Pfam:7tm_4 34 313 6.1e-52 PFAM
Pfam:7tm_1 44 295 1e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 91.2%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik G A 7: 27,574,636 R183Q probably damaging Het
Abca5 A G 11: 110,273,311 probably benign Het
Ada T C 2: 163,728,157 K312R probably benign Het
Adam21 C A 12: 81,560,285 K234N possibly damaging Het
Afdn T A 17: 13,888,514 probably null Het
Aimp1 T G 3: 132,673,986 K132Q possibly damaging Het
Aldh16a1 C T 7: 45,147,979 R135Q probably damaging Het
Alox12b A T 11: 69,167,379 Y519F probably benign Het
Alppl2 T C 1: 87,089,602 E25G probably benign Het
Apob A T 12: 8,012,210 N3531I probably damaging Het
Arhgap23 T C 11: 97,501,109 L321P probably damaging Het
Cab39l C T 14: 59,519,579 Q137* probably null Het
Cenpo A T 12: 4,216,660 H149Q possibly damaging Het
Cpt1a A G 19: 3,378,455 T610A probably benign Het
Dcbld2 A G 16: 58,448,939 T271A probably damaging Het
Dcps A G 9: 35,175,769 probably null Het
Dnaic2 A G 11: 114,752,894 D462G probably benign Het
Dsg2 T A 18: 20,582,695 probably benign Het
Eomes A T 9: 118,484,757 E623D probably benign Het
Fam19a5 T A 15: 87,720,508 I83N probably damaging Het
Fras1 A T 5: 96,596,888 H594L probably benign Het
Gad1-ps T G 10: 99,444,803 noncoding transcript Het
Galk2 A G 2: 125,887,888 Y63C probably damaging Het
H2-T10 A G 17: 36,119,368 L227P probably damaging Het
Itgb4 T G 11: 115,979,412 C73G probably damaging Het
Itpr2 T C 6: 146,311,103 H1472R possibly damaging Het
Kcnh5 C T 12: 75,114,397 A246T probably benign Het
Kpna6 G T 4: 129,649,249 R458S probably benign Het
Lifr A G 15: 7,177,501 T498A probably damaging Het
Lrrd1 T G 5: 3,865,707 I768S probably damaging Het
Map2 T C 1: 66,413,094 V223A probably benign Het
Nod2 G A 8: 88,665,323 A731T probably damaging Het
Nrxn2 G A 19: 6,519,283 C1403Y probably damaging Het
Nxph1 A T 6: 9,247,754 I242F probably damaging Het
Pgr A G 9: 8,902,087 probably benign Het
Pik3cb A G 9: 99,064,076 S566P possibly damaging Het
Sema4d T C 13: 51,712,728 Y242C probably damaging Het
Sftpc T A 14: 70,524,078 probably benign Het
Sh3tc1 T G 5: 35,723,999 E33D probably benign Het
Slc17a5 A G 9: 78,557,537 L344P probably benign Het
Slc39a5 T A 10: 128,398,396 probably benign Het
Slc7a13 C A 4: 19,839,401 H335N probably benign Het
Slco1a4 A C 6: 141,817,753 N412K possibly damaging Het
Sox1 A T 8: 12,396,736 T126S probably damaging Het
Specc1l T A 10: 75,245,829 V353E probably damaging Het
Stat5b T C 11: 100,802,503 E104G probably benign Het
Sult4a1 A G 15: 84,086,667 V179A probably damaging Het
Tbl3 G A 17: 24,705,461 R134C probably damaging Het
Tmem256 T A 11: 69,838,911 probably benign Het
Tmigd1 A G 11: 76,907,134 T101A probably damaging Het
Unc5b C A 10: 60,779,658 probably benign Het
Unc79 T A 12: 103,113,200 S1679T probably benign Het
Vmn2r1 T G 3: 64,089,666 C248G probably damaging Het
Vmn2r57 T C 7: 41,427,543 I400V probably benign Het
Vwa8 T A 14: 79,009,273 L685H probably damaging Het
Yeats4 A G 10: 117,215,836 F172S probably damaging Het
Zfpm2 T G 15: 40,774,035 probably benign Het
Other mutations in Olfr507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Olfr507 APN 7 108621857 missense probably damaging 1.00
IGL01979:Olfr507 APN 7 108622441 missense probably benign 0.09
IGL02373:Olfr507 APN 7 108622103 missense probably benign 0.11
IGL02754:Olfr507 APN 7 108622673 missense possibly damaging 0.94
IGL03008:Olfr507 APN 7 108622283 missense probably damaging 0.99
R0584:Olfr507 UTSW 7 108622415 missense probably benign 0.00
R0611:Olfr507 UTSW 7 108622287 missense possibly damaging 0.72
R0947:Olfr507 UTSW 7 108622672 missense probably benign 0.02
R1488:Olfr507 UTSW 7 108622489 missense probably damaging 1.00
R1808:Olfr507 UTSW 7 108622610 missense possibly damaging 0.87
R3763:Olfr507 UTSW 7 108622717 missense probably damaging 1.00
R4367:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4369:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4371:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4609:Olfr507 UTSW 7 108622504 missense probably benign 0.35
R5389:Olfr507 UTSW 7 108622717 missense probably damaging 1.00
R6499:Olfr507 UTSW 7 108622506 missense probably benign 0.02
R6684:Olfr507 UTSW 7 108621934 missense probably damaging 0.98
R7531:Olfr507 UTSW 7 108622062 missense probably benign 0.06
R7555:Olfr507 UTSW 7 108622726 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGAAGCACAATCTCCTACCTTGGATG -3'
(R):5'- TGTGACAAACAGTGTAGCAGACAAGTC -3'

Sequencing Primer
(F):5'- ACACAAGTCTGTATCCAGTTGC -3'
(R):5'- TGTAGCAGACAAGTCTAAGAAAATG -3'
Posted On2013-04-16