Incidental Mutation 'R2415:Mroh1'
ID248984
Institutional Source Beutler Lab
Gene Symbol Mroh1
Ensembl Gene ENSMUSG00000022558
Gene Namemaestro heat-like repeat family member 1
SynonymsHeatr7a, D330001F17Rik
MMRRC Submission 040379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R2415 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location76380261-76453038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76421211 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 405 (K405E)
Ref Sequence ENSEMBL: ENSMUSP00000124811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092595] [ENSMUST00000096385] [ENSMUST00000159218] [ENSMUST00000161305]
Predicted Effect probably damaging
Transcript: ENSMUST00000092595
AA Change: K405E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090256
Gene: ENSMUSG00000022558
AA Change: K405E

DomainStartEndE-ValueType
SCOP:d1gw5a_ 4 435 4e-10 SMART
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000096385
AA Change: K405E

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000094115
Gene: ENSMUSG00000022558
AA Change: K405E

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 799 810 N/A INTRINSIC
low complexity region 935 946 N/A INTRINSIC
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1355 1367 N/A INTRINSIC
low complexity region 1488 1502 N/A INTRINSIC
Pfam:HEAT 1610 1640 2.2e-5 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159218
AA Change: K405E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124811
Gene: ENSMUSG00000022558
AA Change: K405E

DomainStartEndE-ValueType
low complexity region 442 455 N/A INTRINSIC
low complexity region 594 607 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 926 937 N/A INTRINSIC
low complexity region 1182 1193 N/A INTRINSIC
low complexity region 1346 1358 N/A INTRINSIC
low complexity region 1479 1493 N/A INTRINSIC
Pfam:HEAT 1601 1631 1.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160986
Predicted Effect probably damaging
Transcript: ENSMUST00000161305
AA Change: K405E

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.4940 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano6 A T 15: 95,962,280 N761I probably damaging Het
Atad5 T C 11: 80,094,251 S55P probably damaging Het
Cul9 T A 17: 46,543,438 T113S probably benign Het
Ddx56 G A 11: 6,261,727 probably benign Het
Dnttip2 T C 3: 122,276,537 V467A probably damaging Het
Efhb A T 17: 53,463,096 F62I probably benign Het
Efl1 T A 7: 82,697,967 M567K probably damaging Het
Fbxw21 G T 9: 109,156,401 A103E possibly damaging Het
Flnb T A 14: 7,929,932 S2021T probably benign Het
Gabpa T C 16: 84,844,368 probably null Het
Grid1 A T 14: 35,450,369 I611F possibly damaging Het
Hdac1 A C 4: 129,522,961 probably null Het
Kcnk5 T C 14: 20,141,812 E427G possibly damaging Het
Kcnu1 A T 8: 25,910,878 T685S probably benign Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Ky G T 9: 102,541,891 G366W probably damaging Het
Limch1 T C 5: 66,974,634 S147P probably damaging Het
Myo15b T G 11: 115,879,564 F67V probably benign Het
Nlrp4c A G 7: 6,066,048 D316G probably damaging Het
Nudt12 A G 17: 59,006,608 V325A probably damaging Het
Pdia4 G T 6: 47,806,556 D184E probably benign Het
Per3 A C 4: 151,012,690 F793V possibly damaging Het
Pla1a T A 16: 38,407,750 Y255F possibly damaging Het
Rxfp1 A G 3: 79,663,319 S269P probably benign Het
S100pbp A T 4: 129,181,821 V118D possibly damaging Het
Sec24b A T 3: 129,996,080 I764N probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Surf6 C T 2: 26,892,262 R351H probably damaging Het
Tspan15 A G 10: 62,201,791 I115T probably benign Het
Vmn2r73 T C 7: 85,872,223 Y179C probably damaging Het
Zfp750 T C 11: 121,512,479 D481G probably benign Het
Other mutations in Mroh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Mroh1 APN 15 76432288 missense probably benign 0.01
IGL02141:Mroh1 APN 15 76446599 missense possibly damaging 0.47
IGL02146:Mroh1 APN 15 76434679 splice site probably benign
IGL02205:Mroh1 APN 15 76437239 missense possibly damaging 0.81
IGL02261:Mroh1 APN 15 76429160 missense probably benign 0.03
IGL02818:Mroh1 APN 15 76432401 splice site probably null
IGL02949:Mroh1 APN 15 76408968 missense probably damaging 0.97
IGL02951:Mroh1 APN 15 76427636 missense probably damaging 1.00
IGL03154:Mroh1 APN 15 76452838 missense probably damaging 1.00
IGL02799:Mroh1 UTSW 15 76392461 critical splice donor site probably null
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0068:Mroh1 UTSW 15 76446692 splice site probably benign
R0076:Mroh1 UTSW 15 76451140 missense probably benign 0.00
R0180:Mroh1 UTSW 15 76428250 missense probably damaging 0.99
R0315:Mroh1 UTSW 15 76427600 missense possibly damaging 0.94
R0350:Mroh1 UTSW 15 76432249 missense probably damaging 0.98
R0399:Mroh1 UTSW 15 76452099 missense probably benign 0.44
R0835:Mroh1 UTSW 15 76451883 missense probably damaging 0.96
R0893:Mroh1 UTSW 15 76408938 missense possibly damaging 0.62
R1109:Mroh1 UTSW 15 76446509 splice site probably benign
R1527:Mroh1 UTSW 15 76452263 missense probably benign 0.03
R1595:Mroh1 UTSW 15 76433530 splice site probably benign
R1900:Mroh1 UTSW 15 76433385 missense probably benign 0.00
R1901:Mroh1 UTSW 15 76436049 missense probably benign
R2223:Mroh1 UTSW 15 76408045 critical splice donor site probably null
R3113:Mroh1 UTSW 15 76408536 splice site probably benign
R3437:Mroh1 UTSW 15 76433608 missense possibly damaging 0.92
R3618:Mroh1 UTSW 15 76452346 missense possibly damaging 0.55
R3833:Mroh1 UTSW 15 76401619 missense probably benign 0.08
R4073:Mroh1 UTSW 15 76407985 missense probably benign 0.13
R4156:Mroh1 UTSW 15 76402126 splice site probably null
R4276:Mroh1 UTSW 15 76393851 missense probably damaging 1.00
R4745:Mroh1 UTSW 15 76408530 critical splice donor site probably null
R5450:Mroh1 UTSW 15 76432347 intron probably benign
R5574:Mroh1 UTSW 15 76433931 missense probably benign
R5673:Mroh1 UTSW 15 76430181 missense probably damaging 1.00
R5970:Mroh1 UTSW 15 76451491 missense probably benign 0.24
R5993:Mroh1 UTSW 15 76446680 missense probably damaging 0.99
R6008:Mroh1 UTSW 15 76451357 missense possibly damaging 0.50
R6082:Mroh1 UTSW 15 76430223 missense probably benign 0.06
R6302:Mroh1 UTSW 15 76436119 critical splice donor site probably null
R7030:Mroh1 UTSW 15 76437317 missense probably benign 0.01
R7098:Mroh1 UTSW 15 76408457 nonsense probably null
R7334:Mroh1 UTSW 15 76427638 missense probably benign 0.00
R7337:Mroh1 UTSW 15 76451476 missense probably benign 0.00
R7352:Mroh1 UTSW 15 76451474 missense probably benign 0.06
R7446:Mroh1 UTSW 15 76452272 missense possibly damaging 0.93
R7453:Mroh1 UTSW 15 76433545 missense probably damaging 1.00
R7669:Mroh1 UTSW 15 76451848 missense possibly damaging 0.88
R7753:Mroh1 UTSW 15 76433275 missense possibly damaging 0.62
R7860:Mroh1 UTSW 15 76447332 missense probably benign 0.00
R7943:Mroh1 UTSW 15 76447332 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCGACATGAGGACCAAGTGAG -3'
(R):5'- AGGTGCCTTTGGTTCGCTAC -3'

Sequencing Primer
(F):5'- AAGTGAGGCCAGACCCTTTG -3'
(R):5'- TACCGGTTCACTAAGACAACGTGG -3'
Posted On2014-11-12