Incidental Mutation 'R2415:Efhb'
ID248991
Institutional Source Beutler Lab
Gene Symbol Efhb
Ensembl Gene ENSMUSG00000023931
Gene NameEF hand domain family, member B
Synonyms4921525D22Rik
MMRRC Submission 040379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R2415 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location53398889-53463321 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 53463096 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 62 (F62I)
Ref Sequence ENSEMBL: ENSMUSP00000024725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024725]
Predicted Effect probably benign
Transcript: ENSMUST00000024725
AA Change: F62I

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000024725
Gene: ENSMUSG00000023931
AA Change: F62I

DomainStartEndE-ValueType
low complexity region 565 574 N/A INTRINSIC
EFh 585 613 2.14e-1 SMART
EFh 621 649 1.98e0 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano6 A T 15: 95,962,280 N761I probably damaging Het
Atad5 T C 11: 80,094,251 S55P probably damaging Het
Cul9 T A 17: 46,543,438 T113S probably benign Het
Ddx56 G A 11: 6,261,727 probably benign Het
Dnttip2 T C 3: 122,276,537 V467A probably damaging Het
Efl1 T A 7: 82,697,967 M567K probably damaging Het
Fbxw21 G T 9: 109,156,401 A103E possibly damaging Het
Flnb T A 14: 7,929,932 S2021T probably benign Het
Gabpa T C 16: 84,844,368 probably null Het
Grid1 A T 14: 35,450,369 I611F possibly damaging Het
Hdac1 A C 4: 129,522,961 probably null Het
Kcnk5 T C 14: 20,141,812 E427G possibly damaging Het
Kcnu1 A T 8: 25,910,878 T685S probably benign Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Ky G T 9: 102,541,891 G366W probably damaging Het
Limch1 T C 5: 66,974,634 S147P probably damaging Het
Mroh1 A G 15: 76,421,211 K405E probably damaging Het
Myo15b T G 11: 115,879,564 F67V probably benign Het
Nlrp4c A G 7: 6,066,048 D316G probably damaging Het
Nudt12 A G 17: 59,006,608 V325A probably damaging Het
Pdia4 G T 6: 47,806,556 D184E probably benign Het
Per3 A C 4: 151,012,690 F793V possibly damaging Het
Pla1a T A 16: 38,407,750 Y255F possibly damaging Het
Rxfp1 A G 3: 79,663,319 S269P probably benign Het
S100pbp A T 4: 129,181,821 V118D possibly damaging Het
Sec24b A T 3: 129,996,080 I764N probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Surf6 C T 2: 26,892,262 R351H probably damaging Het
Tspan15 A G 10: 62,201,791 I115T probably benign Het
Vmn2r73 T C 7: 85,872,223 Y179C probably damaging Het
Zfp750 T C 11: 121,512,479 D481G probably benign Het
Other mutations in Efhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Efhb APN 17 53462453 missense probably damaging 1.00
IGL00990:Efhb APN 17 53462621 missense possibly damaging 0.86
IGL02041:Efhb APN 17 53426259 missense probably damaging 1.00
IGL02247:Efhb APN 17 53401624 missense probably benign 0.00
IGL02637:Efhb APN 17 53449552 missense probably benign 0.26
IGL02704:Efhb APN 17 53426269 missense probably damaging 1.00
IGL03083:Efhb APN 17 53399059 missense probably damaging 1.00
IGL03090:Efhb APN 17 53462930 missense probably benign 0.01
IGL03221:Efhb APN 17 53398986 missense probably damaging 1.00
PIT4531001:Efhb UTSW 17 53445775 missense probably damaging 1.00
R0632:Efhb UTSW 17 53413459 splice site probably benign
R1234:Efhb UTSW 17 53451587 nonsense probably null
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1466:Efhb UTSW 17 53437178 missense probably damaging 0.99
R1471:Efhb UTSW 17 53399112 missense possibly damaging 0.46
R1624:Efhb UTSW 17 53426278 missense probably damaging 1.00
R2019:Efhb UTSW 17 53401477 missense probably damaging 1.00
R2085:Efhb UTSW 17 53426909 critical splice donor site probably null
R2226:Efhb UTSW 17 53462429 critical splice donor site probably null
R3848:Efhb UTSW 17 53426996 splice site probably benign
R3858:Efhb UTSW 17 53462780 missense possibly damaging 0.61
R4581:Efhb UTSW 17 53426275 missense probably damaging 1.00
R4712:Efhb UTSW 17 53451669 missense probably damaging 1.00
R4731:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4732:Efhb UTSW 17 53426244 missense probably damaging 1.00
R4733:Efhb UTSW 17 53426244 missense probably damaging 1.00
R5375:Efhb UTSW 17 53401626 missense possibly damaging 0.93
R5886:Efhb UTSW 17 53451554 missense probably benign 0.42
R6054:Efhb UTSW 17 53398999 missense possibly damaging 0.90
R6195:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6233:Efhb UTSW 17 53462552 missense possibly damaging 0.62
R6450:Efhb UTSW 17 53452604 missense possibly damaging 0.77
R6550:Efhb UTSW 17 53421940 missense probably benign 0.06
R6701:Efhb UTSW 17 53399063 missense probably benign 0.41
R6967:Efhb UTSW 17 53463168 missense probably benign 0.03
R7157:Efhb UTSW 17 53400900 missense probably damaging 1.00
R7441:Efhb UTSW 17 53401521 missense possibly damaging 0.78
R7694:Efhb UTSW 17 53400808 missense probably damaging 0.99
R8044:Efhb UTSW 17 53399115 missense probably benign 0.41
R8176:Efhb UTSW 17 53400846 missense probably damaging 1.00
R8309:Efhb UTSW 17 53449535 missense probably damaging 0.99
R8311:Efhb UTSW 17 53413461 critical splice donor site probably null
R8821:Efhb UTSW 17 53400744 critical splice donor site probably benign
R8882:Efhb UTSW 17 53462684 missense probably damaging 1.00
RF003:Efhb UTSW 17 53400891 missense probably damaging 1.00
RF012:Efhb UTSW 17 53413517 missense probably damaging 0.97
Z1177:Efhb UTSW 17 53437126 missense possibly damaging 0.94
Z1177:Efhb UTSW 17 53437183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- CAGAGGTTTTGATCCCTGGAAGG -3'
(R):5'- AGGCAGGAAGTAGTCTGCAC -3'

Sequencing Primer
(F):5'- TTTGATCCCTGGAAGGCAGAGC -3'
(R):5'- AGTAGTCTGCACGGAGTACTG -3'
Posted On2014-11-12