Incidental Mutation 'R2415:Nudt12'
ID248992
Institutional Source Beutler Lab
Gene Symbol Nudt12
Ensembl Gene ENSMUSG00000024228
Gene Namenudix (nucleoside diphosphate linked moiety X)-type motif 12
Synonyms
MMRRC Submission 040379-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2415 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location58999618-59013372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59006608 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 325 (V325A)
Ref Sequence ENSEMBL: ENSMUSP00000133678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025065] [ENSMUST00000174122]
Predicted Effect probably damaging
Transcript: ENSMUST00000025065
AA Change: V325A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025065
Gene: ENSMUSG00000024228
AA Change: V325A

DomainStartEndE-ValueType
ANK 11 40 2.43e3 SMART
ANK 45 74 1.1e-6 SMART
ANK 78 108 2.55e2 SMART
Pfam:NUDIX-like 147 277 3.2e-10 PFAM
Pfam:zf-NADH-PPase 279 309 2.7e-10 PFAM
Pfam:NUDIX 322 447 8.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152750
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174108
Predicted Effect probably damaging
Transcript: ENSMUST00000174122
AA Change: V325A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133678
Gene: ENSMUSG00000024228
AA Change: V325A

DomainStartEndE-ValueType
ANK 11 40 2.43e3 SMART
ANK 45 74 1.1e-6 SMART
ANK 78 108 2.55e2 SMART
Pfam:NUDIX-like 147 277 2.4e-9 PFAM
Pfam:zf-NADH-PPase 279 311 5.9e-11 PFAM
Meta Mutation Damage Score 0.4199 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.2%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleotides are involved in numerous biochemical reactions and pathways within the cell as substrates, cofactors, and effectors. Nudix hydrolases, such as NUDT12, regulate the concentrations of individual nucleotides and of nucleotide ratios in response to changing circumstances (Abdelraheim et al., 2003 [PubMed 12790796]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano6 A T 15: 95,962,280 N761I probably damaging Het
Atad5 T C 11: 80,094,251 S55P probably damaging Het
Cul9 T A 17: 46,543,438 T113S probably benign Het
Ddx56 G A 11: 6,261,727 probably benign Het
Dnttip2 T C 3: 122,276,537 V467A probably damaging Het
Efhb A T 17: 53,463,096 F62I probably benign Het
Efl1 T A 7: 82,697,967 M567K probably damaging Het
Fbxw21 G T 9: 109,156,401 A103E possibly damaging Het
Flnb T A 14: 7,929,932 S2021T probably benign Het
Gabpa T C 16: 84,844,368 probably null Het
Grid1 A T 14: 35,450,369 I611F possibly damaging Het
Hdac1 A C 4: 129,522,961 probably null Het
Kcnk5 T C 14: 20,141,812 E427G possibly damaging Het
Kcnu1 A T 8: 25,910,878 T685S probably benign Het
Khdc1b A G 1: 21,384,310 D79G probably benign Het
Ky G T 9: 102,541,891 G366W probably damaging Het
Limch1 T C 5: 66,974,634 S147P probably damaging Het
Mroh1 A G 15: 76,421,211 K405E probably damaging Het
Myo15b T G 11: 115,879,564 F67V probably benign Het
Nlrp4c A G 7: 6,066,048 D316G probably damaging Het
Pdia4 G T 6: 47,806,556 D184E probably benign Het
Per3 A C 4: 151,012,690 F793V possibly damaging Het
Pla1a T A 16: 38,407,750 Y255F possibly damaging Het
Rxfp1 A G 3: 79,663,319 S269P probably benign Het
S100pbp A T 4: 129,181,821 V118D possibly damaging Het
Sec24b A T 3: 129,996,080 I764N probably benign Het
Sh3bp1 C T 15: 78,901,161 probably benign Het
Surf6 C T 2: 26,892,262 R351H probably damaging Het
Tspan15 A G 10: 62,201,791 I115T probably benign Het
Vmn2r73 T C 7: 85,872,223 Y179C probably damaging Het
Zfp750 T C 11: 121,512,479 D481G probably benign Het
Other mutations in Nudt12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02860:Nudt12 APN 17 59010435 missense probably benign 0.01
IGL02904:Nudt12 APN 17 59010352 missense probably benign 0.00
IGL03206:Nudt12 APN 17 59007672 missense probably benign 0.00
R0121:Nudt12 UTSW 17 59007639 missense possibly damaging 0.80
R0673:Nudt12 UTSW 17 59007622 critical splice donor site probably null
R0761:Nudt12 UTSW 17 59011069 missense probably benign 0.00
R1079:Nudt12 UTSW 17 59011037 splice site probably benign
R1277:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1815:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1816:Nudt12 UTSW 17 59010136 missense probably damaging 0.98
R1834:Nudt12 UTSW 17 59011076 missense probably damaging 1.00
R2296:Nudt12 UTSW 17 59010049 missense possibly damaging 0.85
R5011:Nudt12 UTSW 17 58996504 unclassified probably benign
R5384:Nudt12 UTSW 17 59003439 missense probably damaging 1.00
R5385:Nudt12 UTSW 17 59003439 missense probably damaging 1.00
R5874:Nudt12 UTSW 17 59010284 nonsense probably null
R6108:Nudt12 UTSW 17 59007749 missense probably damaging 1.00
R6477:Nudt12 UTSW 17 59011145 missense probably benign 0.12
R7030:Nudt12 UTSW 17 59003353 missense probably benign 0.22
R7592:Nudt12 UTSW 17 59006594 missense probably benign 0.02
R8252:Nudt12 UTSW 17 59011094 missense probably damaging 0.99
Z1177:Nudt12 UTSW 17 59011071 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGCTTTATGCCACGGTAC -3'
(R):5'- TGTTGCTAAGATTGGAAGTAAGGAC -3'

Sequencing Primer
(F):5'- TGCCACGGTACTTACTGAATTG -3'
(R):5'- CTTTCACTTACTAAAGACAGTCTGC -3'
Posted On2014-11-12