Incidental Mutation 'R2416:Eya1'
ID248994
Institutional Source Beutler Lab
Gene Symbol Eya1
Ensembl Gene ENSMUSG00000025932
Gene NameEYA transcriptional coactivator and phosphatase 1
Synonymsbor
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R2416 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location14168954-14310235 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 14270703 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027066] [ENSMUST00000080664] [ENSMUST00000168081] [ENSMUST00000185453] [ENSMUST00000187790] [ENSMUST00000188857] [ENSMUST00000190337]
Predicted Effect probably null
Transcript: ENSMUST00000027066
SMART Domains Protein: ENSMUSP00000027066
Gene: ENSMUSG00000025932

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Predicted Effect probably null
Transcript: ENSMUST00000080664
SMART Domains Protein: ENSMUSP00000079493
Gene: ENSMUSG00000025932

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 256 280 N/A INTRINSIC
PDB:3HB1|D 281 552 1e-173 PDB
Predicted Effect probably null
Transcript: ENSMUST00000168081
SMART Domains Protein: ENSMUSP00000126383
Gene: ENSMUSG00000025932

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 207 219 N/A INTRINSIC
low complexity region 262 286 N/A INTRINSIC
PDB:3HB1|D 287 558 1e-172 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000185453
SMART Domains Protein: ENSMUSP00000141072
Gene: ENSMUSG00000025932

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187790
SMART Domains Protein: ENSMUSP00000139542
Gene: ENSMUSG00000025932

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000188857
SMART Domains Protein: ENSMUSP00000140171
Gene: ENSMUSG00000025932

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000190337
SMART Domains Protein: ENSMUSP00000141112
Gene: ENSMUSG00000025932

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mutations in this locus affect inner ear morphology and hearing, and result in dysmorphic or absent kidneys. Hypomorphs are deaf and circle. Null homozygotes additionally show agenesis of thymus and parathyroid and thyroid hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cep152 A T 2: 125,564,172 L1480* probably null Het
Cryba1 T A 11: 77,720,900 I116F probably damaging Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eif3m G T 2: 105,013,833 P76T probably benign Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Glyat T A 19: 12,651,254 S138T possibly damaging Het
Gm10093 G T 17: 78,492,516 W312L probably damaging Het
Gpr160 A G 3: 30,896,009 T77A probably benign Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Park7 A G 4: 150,908,401 S3P probably benign Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Zfp382 A G 7: 30,134,403 Y493C probably damaging Het
Other mutations in Eya1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Eya1 APN 1 14270701 splice site probably benign
IGL01110:Eya1 APN 1 14283130 missense probably damaging 1.00
IGL02266:Eya1 APN 1 14184501 missense possibly damaging 0.63
IGL03027:Eya1 APN 1 14170966 missense probably damaging 1.00
IGL03081:Eya1 APN 1 14183191 missense possibly damaging 0.76
IGL03291:Eya1 APN 1 14184348 critical splice donor site probably null
IGL03353:Eya1 APN 1 14179527 missense probably damaging 1.00
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R1428:Eya1 UTSW 1 14304414 splice site probably benign
R1521:Eya1 UTSW 1 14274550 missense probably damaging 0.99
R1571:Eya1 UTSW 1 14208917 missense probably damaging 1.00
R1768:Eya1 UTSW 1 14253075 missense possibly damaging 0.95
R1785:Eya1 UTSW 1 14170974 missense probably benign 0.16
R1840:Eya1 UTSW 1 14229504 nonsense probably null
R2114:Eya1 UTSW 1 14270774 missense probably damaging 1.00
R2131:Eya1 UTSW 1 14170974 missense probably benign 0.16
R2212:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R2424:Eya1 UTSW 1 14270848 splice site probably benign
R3085:Eya1 UTSW 1 14274090 missense probably benign 0.01
R3158:Eya1 UTSW 1 14304467 start gained probably benign
R3412:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3413:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3693:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3694:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3899:Eya1 UTSW 1 14270747 missense probably benign 0.04
R4454:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4455:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4456:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4458:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4761:Eya1 UTSW 1 14302821 missense probably damaging 1.00
R5011:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5013:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5613:Eya1 UTSW 1 14302929 intron probably benign
R5687:Eya1 UTSW 1 14183252 missense probably damaging 0.99
R6052:Eya1 UTSW 1 14283150 missense probably damaging 1.00
R6181:Eya1 UTSW 1 14302872 missense probably damaging 0.99
R6378:Eya1 UTSW 1 14302803 missense possibly damaging 0.93
R6805:Eya1 UTSW 1 14183277 missense probably benign 0.00
R6863:Eya1 UTSW 1 14270975 intron probably null
R7032:Eya1 UTSW 1 14283200 critical splice acceptor site probably null
R7044:Eya1 UTSW 1 14231410 splice site probably null
R7078:Eya1 UTSW 1 14231412 critical splice donor site probably null
R7179:Eya1 UTSW 1 14302852 missense probably damaging 1.00
R7384:Eya1 UTSW 1 14229512 missense probably damaging 1.00
R7462:Eya1 UTSW 1 14231414 missense probably null 0.99
Z1176:Eya1 UTSW 1 14302868 missense probably damaging 1.00
Z1176:Eya1 UTSW 1 14252430 missense probably benign
Z1177:Eya1 UTSW 1 14184429 missense probably damaging 0.98
Z1177:Eya1 UTSW 1 14253090 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- AAAATCTTGGTTCAGAGCGC -3'
(R):5'- AGAACTGTGGGAATTTGACTGG -3'

Sequencing Primer
(F):5'- CGCAGCAAATGAAGAACCTAATTTG -3'
(R):5'- CCAGCTTCTGAAAATGAACAGATAG -3'
Posted On2014-11-12