Incidental Mutation 'R2416:Eif3m'
ID248997
Institutional Source Beutler Lab
Gene Symbol Eif3m
Ensembl Gene ENSMUSG00000027170
Gene Nameeukaryotic translation initiation factor 3, subunit M
SynonymsGa17, Pcid1, Tango7
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2416 (G1)
Quality Score216
Status Not validated
Chromosome2
Chromosomal Location104999656-105017080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105013833 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 76 (P76T)
Ref Sequence ENSEMBL: ENSMUSP00000028592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028592] [ENSMUST00000111110]
Predicted Effect probably benign
Transcript: ENSMUST00000028592
AA Change: P76T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028592
Gene: ENSMUSG00000027170
AA Change: P76T

DomainStartEndE-ValueType
Blast:HDc 119 209 1e-12 BLAST
PINT 268 357 6.42e-26 SMART
low complexity region 358 372 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111110
SMART Domains Protein: ENSMUSP00000106739
Gene: ENSMUSG00000027170

DomainStartEndE-ValueType
Blast:HDc 13 77 7e-8 BLAST
PINT 136 225 6.42e-26 SMART
low complexity region 226 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130611
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the eurkaryotic translation initiation factor 3 complete (eIF-3) required for protein synthesis. Elevated levels of the encoded protein are present in cancer cell lines. Inactivation of the encoded protein has been shown to interfere with translation of herpes virus mRNAs by preventing the association of mRNAs with the ribosomes. A pseudogene of this gene is located on the X chromosome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit decreased body weight and altered organ weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cep152 A T 2: 125,564,172 L1480* probably null Het
Cryba1 T A 11: 77,720,900 I116F probably damaging Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eya1 A G 1: 14,270,703 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Glyat T A 19: 12,651,254 S138T possibly damaging Het
Gm10093 G T 17: 78,492,516 W312L probably damaging Het
Gpr160 A G 3: 30,896,009 T77A probably benign Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Park7 A G 4: 150,908,401 S3P probably benign Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Zfp382 A G 7: 30,134,403 Y493C probably damaging Het
Other mutations in Eif3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Eif3m APN 2 105012843 intron probably benign
IGL02661:Eif3m APN 2 105004969 missense probably damaging 0.98
IGL02932:Eif3m APN 2 105014869 missense probably damaging 1.00
R0039:Eif3m UTSW 2 105005872 missense probably damaging 1.00
R0373:Eif3m UTSW 2 105005000 missense probably benign 0.06
R1452:Eif3m UTSW 2 105006777 missense probably damaging 1.00
R1695:Eif3m UTSW 2 105016953 missense probably damaging 0.98
R1934:Eif3m UTSW 2 105001279 missense probably damaging 1.00
R2115:Eif3m UTSW 2 105006796 missense probably damaging 1.00
R4610:Eif3m UTSW 2 105013288 missense probably benign 0.08
R4713:Eif3m UTSW 2 105006839 unclassified probably null
R5373:Eif3m UTSW 2 105012932 missense probably damaging 0.99
R5374:Eif3m UTSW 2 105012932 missense probably damaging 0.99
R5725:Eif3m UTSW 2 105013841 missense probably damaging 0.97
R7996:Eif3m UTSW 2 105001349 missense probably benign 0.22
Z1088:Eif3m UTSW 2 105013256 missense probably damaging 1.00
Z1177:Eif3m UTSW 2 105001274 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATCCCTCTGAATGCTGTATC -3'
(R):5'- TAACTTTCACAGTAGGCAAGCTATG -3'

Sequencing Primer
(F):5'- TACTGGATCTCCAAGAGCTGG -3'
(R):5'- CAGTAGGCAAGCTATGTATTTTAAGC -3'
Posted On2014-11-12