Incidental Mutation 'R2416:Cep152'
ID248998
Institutional Source Beutler Lab
Gene Symbol Cep152
Ensembl Gene ENSMUSG00000068394
Gene Namecentrosomal protein 152
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2416 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location125563088-125625113 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 125564172 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 1480 (L1480*)
Ref Sequence ENSEMBL: ENSMUSP00000087208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089776]
Predicted Effect probably null
Transcript: ENSMUST00000089776
AA Change: L1480*
SMART Domains Protein: ENSMUSP00000087208
Gene: ENSMUSG00000068394
AA Change: L1480*

DomainStartEndE-ValueType
low complexity region 15 29 N/A INTRINSIC
low complexity region 106 124 N/A INTRINSIC
coiled coil region 228 481 N/A INTRINSIC
low complexity region 582 593 N/A INTRINSIC
coiled coil region 602 651 N/A INTRINSIC
coiled coil region 692 770 N/A INTRINSIC
low complexity region 780 793 N/A INTRINSIC
coiled coil region 835 868 N/A INTRINSIC
coiled coil region 954 1038 N/A INTRINSIC
coiled coil region 1205 1277 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is thought to be involved with centrosome function. Mutations in this gene have been associated with primary microcephaly (MCPH4). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
PHENOTYPE: Embryos homozygous for a null allele exhibit reduced numbers of centrosomes and cilia, increased apoptosis, and midgestation lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cryba1 T A 11: 77,720,900 I116F probably damaging Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eif3m G T 2: 105,013,833 P76T probably benign Het
Eya1 A G 1: 14,270,703 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Glyat T A 19: 12,651,254 S138T possibly damaging Het
Gm10093 G T 17: 78,492,516 W312L probably damaging Het
Gpr160 A G 3: 30,896,009 T77A probably benign Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Park7 A G 4: 150,908,401 S3P probably benign Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Zfp382 A G 7: 30,134,403 Y493C probably damaging Het
Other mutations in Cep152
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cep152 APN 2 125563888 missense probably benign 0.01
IGL00561:Cep152 APN 2 125563723 nonsense probably null
IGL01082:Cep152 APN 2 125569545 splice site probably benign
IGL01420:Cep152 APN 2 125563652 missense possibly damaging 0.49
IGL01832:Cep152 APN 2 125618494 nonsense probably null
IGL02106:Cep152 APN 2 125602936 splice site probably null
IGL02124:Cep152 APN 2 125563461 missense probably benign 0.23
IGL02349:Cep152 APN 2 125594956 missense probably damaging 0.99
IGL02541:Cep152 APN 2 125605354 missense probably damaging 1.00
IGL02659:Cep152 APN 2 125579549 missense probably damaging 0.96
IGL02711:Cep152 APN 2 125563942 missense possibly damaging 0.93
IGL02737:Cep152 APN 2 125586474 missense possibly damaging 0.71
IGL03060:Cep152 APN 2 125619987 splice site probably benign
IGL03095:Cep152 APN 2 125618451 missense probably benign 0.00
IGL03186:Cep152 APN 2 125563975 missense probably benign
IGL03306:Cep152 APN 2 125605408 missense possibly damaging 0.90
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0034:Cep152 UTSW 2 125583893 missense probably benign 0.00
R0079:Cep152 UTSW 2 125618453 missense possibly damaging 0.92
R0244:Cep152 UTSW 2 125564214 missense probably benign 0.00
R0390:Cep152 UTSW 2 125576869 splice site probably benign
R0462:Cep152 UTSW 2 125583934 missense possibly damaging 0.64
R0480:Cep152 UTSW 2 125581719 missense possibly damaging 0.95
R0595:Cep152 UTSW 2 125595063 missense probably damaging 0.99
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R0973:Cep152 UTSW 2 125594899 missense probably benign 0.00
R1634:Cep152 UTSW 2 125583889 missense probably benign 0.00
R1664:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1693:Cep152 UTSW 2 125566254 missense probably benign 0.38
R1887:Cep152 UTSW 2 125620305 missense probably benign 0.00
R1930:Cep152 UTSW 2 125618371 critical splice donor site probably null
R2178:Cep152 UTSW 2 125580034 splice site probably null
R2225:Cep152 UTSW 2 125581784 missense probably damaging 1.00
R2324:Cep152 UTSW 2 125563462 missense probably benign 0.38
R2845:Cep152 UTSW 2 125587974 missense probably damaging 1.00
R3753:Cep152 UTSW 2 125625052 unclassified probably benign
R4212:Cep152 UTSW 2 125620001 missense probably benign 0.00
R4304:Cep152 UTSW 2 125563723 nonsense probably null
R4371:Cep152 UTSW 2 125613047 missense probably damaging 1.00
R4399:Cep152 UTSW 2 125587980 missense possibly damaging 0.63
R4536:Cep152 UTSW 2 125602947 splice site probably null
R4713:Cep152 UTSW 2 125587948 missense possibly damaging 0.79
R4777:Cep152 UTSW 2 125564095 missense probably benign 0.29
R4779:Cep152 UTSW 2 125568892 missense possibly damaging 0.52
R4785:Cep152 UTSW 2 125586329 critical splice donor site probably null
R4816:Cep152 UTSW 2 125563754 missense probably damaging 1.00
R4847:Cep152 UTSW 2 125618474 missense possibly damaging 0.62
R4898:Cep152 UTSW 2 125586381 missense probably benign 0.03
R4934:Cep152 UTSW 2 125611096 missense possibly damaging 0.52
R4997:Cep152 UTSW 2 125586351 missense probably benign 0.00
R5068:Cep152 UTSW 2 125571816 missense probably benign 0.25
R5183:Cep152 UTSW 2 125566638 missense probably damaging 1.00
R5198:Cep152 UTSW 2 125587624 missense probably benign
R5261:Cep152 UTSW 2 125564205 missense probably benign 0.06
R5272:Cep152 UTSW 2 125611030 missense probably benign 0.27
R5284:Cep152 UTSW 2 125580021 missense probably damaging 1.00
R6029:Cep152 UTSW 2 125563632 missense probably benign 0.44
R6155:Cep152 UTSW 2 125581700 missense probably benign
R6239:Cep152 UTSW 2 125579412 missense probably benign 0.40
R6590:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6690:Cep152 UTSW 2 125564370 missense probably damaging 1.00
R6754:Cep152 UTSW 2 125587668 missense probably damaging 0.99
R6798:Cep152 UTSW 2 125566527 splice site probably null
R6816:Cep152 UTSW 2 125595027 missense probably damaging 1.00
R6977:Cep152 UTSW 2 125568822 critical splice donor site probably null
R7125:Cep152 UTSW 2 125566673 nonsense probably null
R7146:Cep152 UTSW 2 125614405 missense probably benign 0.06
R7588:Cep152 UTSW 2 125569626 missense probably damaging 1.00
R7852:Cep152 UTSW 2 125590113 missense possibly damaging 0.82
R7883:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
R7935:Cep152 UTSW 2 125590113 missense possibly damaging 0.82
R7966:Cep152 UTSW 2 125613058 missense possibly damaging 0.50
R8047:Cep152 UTSW 2 125564327 missense probably benign 0.10
R8082:Cep152 UTSW 2 125586393 missense probably benign
X0009:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0010:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0011:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0014:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0017:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0021:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0022:Cep152 UTSW 2 125620063 missense probably benign 0.07
X0023:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0028:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0033:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0064:Cep152 UTSW 2 125614386 missense probably damaging 1.00
X0067:Cep152 UTSW 2 125614386 missense probably damaging 1.00
Z1176:Cep152 UTSW 2 125583971 missense probably benign 0.23
Z1177:Cep152 UTSW 2 125614324 missense probably benign 0.33
Z1177:Cep152 UTSW 2 125619704 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTCTTTTCGGCACCTCCAAG -3'
(R):5'- ATGCTGACGGGCACTGAAAG -3'

Sequencing Primer
(F):5'- TTTCGGCACCTCCAAGGAAGG -3'
(R):5'- TCAGAAAGGAGTGGTGTGAATCAC -3'
Posted On2014-11-12