Incidental Mutation 'R2416:Gpr160'
ID249000
Institutional Source Beutler Lab
Gene Symbol Gpr160
Ensembl Gene ENSMUSG00000037661
Gene NameG protein-coupled receptor 160
Synonyms1700025D19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2416 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location30855950-30897192 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30896009 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 77 (T77A)
Ref Sequence ENSEMBL: ENSMUSP00000128666 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046624] [ENSMUST00000046748] [ENSMUST00000108258] [ENSMUST00000108259] [ENSMUST00000108261] [ENSMUST00000147697] [ENSMUST00000166278] [ENSMUST00000168645] [ENSMUST00000194979]
Predicted Effect probably benign
Transcript: ENSMUST00000046624
SMART Domains Protein: ENSMUSP00000037862
Gene: ENSMUSG00000037652

DomainStartEndE-ValueType
low complexity region 18 40 N/A INTRINSIC
low complexity region 72 89 N/A INTRINSIC
low complexity region 92 142 N/A INTRINSIC
low complexity region 152 166 N/A INTRINSIC
low complexity region 206 224 N/A INTRINSIC
low complexity region 333 359 N/A INTRINSIC
low complexity region 393 419 N/A INTRINSIC
low complexity region 512 538 N/A INTRINSIC
low complexity region 564 578 N/A INTRINSIC
low complexity region 583 594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000046748
AA Change: T77A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045165
Gene: ENSMUSG00000037661
AA Change: T77A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 185 207 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
transmembrane domain 277 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108258
AA Change: T77A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103893
Gene: ENSMUSG00000037661
AA Change: T77A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 185 207 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
transmembrane domain 277 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108259
AA Change: T77A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103894
Gene: ENSMUSG00000037661
AA Change: T77A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 185 207 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
transmembrane domain 277 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108261
AA Change: T77A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000103896
Gene: ENSMUSG00000037661
AA Change: T77A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 185 207 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
transmembrane domain 277 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147697
Predicted Effect probably benign
Transcript: ENSMUST00000166278
AA Change: T77A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000128666
Gene: ENSMUSG00000037661
AA Change: T77A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 54 76 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 185 207 N/A INTRINSIC
transmembrane domain 240 262 N/A INTRINSIC
transmembrane domain 277 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168645
SMART Domains Protein: ENSMUSP00000130142
Gene: ENSMUSG00000037652

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 60 77 N/A INTRINSIC
low complexity region 80 130 N/A INTRINSIC
low complexity region 140 154 N/A INTRINSIC
low complexity region 194 212 N/A INTRINSIC
low complexity region 321 347 N/A INTRINSIC
low complexity region 381 407 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 552 566 N/A INTRINSIC
low complexity region 571 601 N/A INTRINSIC
low complexity region 640 648 N/A INTRINSIC
low complexity region 658 686 N/A INTRINSIC
PDB:2L8E|A 775 811 7e-9 PDB
low complexity region 879 898 N/A INTRINSIC
SAM 914 980 1.6e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194979
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cep152 A T 2: 125,564,172 L1480* probably null Het
Cryba1 T A 11: 77,720,900 I116F probably damaging Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eif3m G T 2: 105,013,833 P76T probably benign Het
Eya1 A G 1: 14,270,703 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Glyat T A 19: 12,651,254 S138T possibly damaging Het
Gm10093 G T 17: 78,492,516 W312L probably damaging Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Park7 A G 4: 150,908,401 S3P probably benign Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Zfp382 A G 7: 30,134,403 Y493C probably damaging Het
Other mutations in Gpr160
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00768:Gpr160 APN 3 30895949 missense probably damaging 1.00
IGL01505:Gpr160 APN 3 30895853 missense possibly damaging 0.90
IGL02952:Gpr160 APN 3 30896294 missense probably benign 0.00
R2259:Gpr160 UTSW 3 30896295 missense probably damaging 0.99
R4191:Gpr160 UTSW 3 30896714 missense possibly damaging 0.65
R4688:Gpr160 UTSW 3 30896686 missense probably benign 0.28
R5987:Gpr160 UTSW 3 30896463 missense probably benign
R6209:Gpr160 UTSW 3 30895992 missense possibly damaging 0.56
R6353:Gpr160 UTSW 3 30896022 missense probably damaging 1.00
R7075:Gpr160 UTSW 3 30896777 missense possibly damaging 0.52
R8261:Gpr160 UTSW 3 30895947 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- CGTCAGACTGCCTTGAAATTTAAC -3'
(R):5'- TAGATGACTGCTTGCTGGCTC -3'

Sequencing Primer
(F):5'- AGCTCTTTCTTCAAAGAACTGC -3'
(R):5'- TGGCTCTGGACAGATTACACCAG -3'
Posted On2014-11-12