Incidental Mutation 'R2416:Fam43b'
ID249001
Institutional Source Beutler Lab
Gene Symbol Fam43b
Ensembl Gene ENSMUSG00000078235
Gene Namefamily with sequence similarity 43, member B
SynonymsOTTMUSG00000009974
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R2416 (G1)
Quality Score93
Status Not validated
Chromosome4
Chromosomal Location138394092-138396528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 138395098 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 304 (R304G)
Ref Sequence ENSEMBL: ENSMUSP00000100649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105032]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000062902
Predicted Effect probably benign
Transcript: ENSMUST00000105032
AA Change: R304G

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100649
Gene: ENSMUSG00000078235
AA Change: R304G

DomainStartEndE-ValueType
Pfam:PID_2 71 265 3.4e-75 PFAM
low complexity region 306 315 N/A INTRINSIC
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cep152 A T 2: 125,564,172 L1480* probably null Het
Cryba1 T A 11: 77,720,900 I116F probably damaging Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eif3m G T 2: 105,013,833 P76T probably benign Het
Eya1 A G 1: 14,270,703 probably null Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Glyat T A 19: 12,651,254 S138T possibly damaging Het
Gm10093 G T 17: 78,492,516 W312L probably damaging Het
Gpr160 A G 3: 30,896,009 T77A probably benign Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Park7 A G 4: 150,908,401 S3P probably benign Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Zfp382 A G 7: 30,134,403 Y493C probably damaging Het
Other mutations in Fam43b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2128:Fam43b UTSW 4 138395988 missense possibly damaging 0.87
R2258:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2281:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2413:Fam43b UTSW 4 138395098 missense probably benign 0.25
R2417:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3705:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3715:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3797:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3798:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3854:Fam43b UTSW 4 138395098 missense probably benign 0.25
R3856:Fam43b UTSW 4 138395098 missense probably benign 0.25
R4639:Fam43b UTSW 4 138395967 missense possibly damaging 0.66
R4868:Fam43b UTSW 4 138395797 missense probably benign 0.32
R5129:Fam43b UTSW 4 138395472 nonsense probably null
R6176:Fam43b UTSW 4 138395211 missense probably damaging 0.99
R7296:Fam43b UTSW 4 138395841 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCAAGGCGACCATTACAGTG -3'
(R):5'- AGTCTTCACCTGGGTCTACC -3'

Sequencing Primer
(F):5'- GACCATTACAGTGACCGCGAG -3'
(R):5'- TTCAGCGACTTCAAGCGG -3'
Posted On2014-11-12