Incidental Mutation 'R2416:Park7'
ID249002
Institutional Source Beutler Lab
Gene Symbol Park7
Ensembl Gene ENSMUSG00000028964
Gene NameParkinson disease (autosomal recessive, early onset) 7
SynonymsDJ-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.373) question?
Stock #R2416 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location150897133-150914437 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 150908401 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 3 (S3P)
Ref Sequence ENSEMBL: ENSMUSP00000122265 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030805] [ENSMUST00000105673] [ENSMUST00000105674] [ENSMUST00000105675] [ENSMUST00000105676] [ENSMUST00000128075] [ENSMUST00000134751] [ENSMUST00000146184]
Predicted Effect probably benign
Transcript: ENSMUST00000030805
AA Change: S3P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030805
Gene: ENSMUSG00000028964
AA Change: S3P

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105673
AA Change: S3P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101298
Gene: ENSMUSG00000028964
AA Change: S3P

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105674
AA Change: S3P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101299
Gene: ENSMUSG00000028964
AA Change: S3P

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 4 171 1.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105675
AA Change: S3P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101300
Gene: ENSMUSG00000028964
AA Change: S3P

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.4e-17 PFAM
Pfam:DJ-1_PfpI 32 173 8.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105676
AA Change: S3P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000101301
Gene: ENSMUSG00000028964
AA Change: S3P

DomainStartEndE-ValueType
Pfam:DUF4066 9 170 1.7e-16 PFAM
Pfam:DJ-1_PfpI 32 171 3.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128075
AA Change: S3P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000115875
Gene: ENSMUSG00000028964
AA Change: S3P

DomainStartEndE-ValueType
Pfam:DUF4066 9 135 1.1e-15 PFAM
Pfam:DJ-1_PfpI 32 136 1.2e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134751
AA Change: S3P

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000122265
Gene: ENSMUSG00000028964
AA Change: S3P

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 114 6.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146184
AA Change: S3P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120832
Gene: ENSMUSG00000028964
AA Change: S3P

DomainStartEndE-ValueType
Pfam:DJ-1_PfpI 32 84 4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148626
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the peptidase C56 family of proteins. It acts as a positive regulator of androgen receptor-dependent transcription. It may also function as a redox-sensitive chaperone, as a sensor for oxidative stress, and it apparently protects neurons against oxidative stress and cell death. Defects in this gene are the cause of autosomal recessive early-onset Parkinson disease 7. Two transcript variants encoding the same protein have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit reduced evoked dopamine overflow in the striatum, resulting primarily from increased dopamine uptake. Mice show hyopactivity, absent long-term depression in medium spiny neurons and decreased sensitivity of nigral neurons to dopamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cep152 A T 2: 125,564,172 L1480* probably null Het
Cryba1 T A 11: 77,720,900 I116F probably damaging Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eif3m G T 2: 105,013,833 P76T probably benign Het
Eya1 A G 1: 14,270,703 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Glyat T A 19: 12,651,254 S138T possibly damaging Het
Gm10093 G T 17: 78,492,516 W312L probably damaging Het
Gpr160 A G 3: 30,896,009 T77A probably benign Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Zfp382 A G 7: 30,134,403 Y493C probably damaging Het
Other mutations in Park7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02137:Park7 APN 4 150903831 missense probably benign 0.28
R0268:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R0344:Park7 UTSW 4 150908349 missense possibly damaging 0.94
R2062:Park7 UTSW 4 150905275 missense probably benign 0.05
R3032:Park7 UTSW 4 150901052 missense probably benign 0.00
R4638:Park7 UTSW 4 150907099 nonsense probably null
R5345:Park7 UTSW 4 150908423 splice site probably benign
R6585:Park7 UTSW 4 150905264 missense probably benign 0.01
R8155:Park7 UTSW 4 150907090 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CGTGTCACATAAACACAGAGTGG -3'
(R):5'- AACTCTGCCATGTGAACCAG -3'

Sequencing Primer
(F):5'- ACATCTGCACCACGGGATG -3'
(R):5'- CTGCCATGTGAACCAGTTTTAATC -3'
Posted On2014-11-12