Incidental Mutation 'R2416:Zfp382'
ID249007
Institutional Source Beutler Lab
Gene Symbol Zfp382
Ensembl Gene ENSMUSG00000074220
Gene Namezinc finger protein 382
Synonyms5930415A09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R2416 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30121942-30134950 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30134403 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 493 (Y493C)
Ref Sequence ENSEMBL: ENSMUSP00000096196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098596] [ENSMUST00000153792]
Predicted Effect probably damaging
Transcript: ENSMUST00000098596
AA Change: Y493C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096196
Gene: ENSMUSG00000074220
AA Change: Y493C

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
KRAB 42 102 3.36e-39 SMART
ZnF_C2H2 325 347 1.84e-4 SMART
ZnF_C2H2 353 375 7.26e-3 SMART
ZnF_C2H2 381 403 2.71e-2 SMART
ZnF_C2H2 409 431 4.47e-3 SMART
ZnF_C2H2 437 459 2.12e-4 SMART
ZnF_C2H2 465 487 3.95e-4 SMART
ZnF_C2H2 493 515 1.12e-3 SMART
ZnF_C2H2 521 543 2.57e-3 SMART
ZnF_C2H2 549 571 3.63e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153792
SMART Domains Protein: ENSMUSP00000123508
Gene: ENSMUSG00000074220

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156543
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a KRAB domain zinc finger transcription factor (KZNF). KZNFs play critical roles in the regulation of many cellular processes including differentiation, proliferation and apoptosis. The encoded protein inhibits activating protein 1 (AP-1) and nuclear factor kappa-B (NF-kB) signaling and may function as a tumor suppressor in multiple carcinomas. This gene is found in a cluster with other zinc finger protein genes on the long arm of chromosome 19, and alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cep152 A T 2: 125,564,172 L1480* probably null Het
Cryba1 T A 11: 77,720,900 I116F probably damaging Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eif3m G T 2: 105,013,833 P76T probably benign Het
Eya1 A G 1: 14,270,703 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Glyat T A 19: 12,651,254 S138T possibly damaging Het
Gm10093 G T 17: 78,492,516 W312L probably damaging Het
Gpr160 A G 3: 30,896,009 T77A probably benign Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Park7 A G 4: 150,908,401 S3P probably benign Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Other mutations in Zfp382
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02724:Zfp382 APN 7 30133737 missense probably benign 0.00
IGL03116:Zfp382 APN 7 30134189 missense probably damaging 1.00
R1051:Zfp382 UTSW 7 30134010 missense probably damaging 1.00
R1371:Zfp382 UTSW 7 30133689 missense probably benign 0.36
R1513:Zfp382 UTSW 7 30133296 missense probably benign 0.04
R1525:Zfp382 UTSW 7 30133719 missense probably damaging 0.99
R2432:Zfp382 UTSW 7 30133749 missense probably benign
R4864:Zfp382 UTSW 7 30133460 missense possibly damaging 0.58
R4956:Zfp382 UTSW 7 30131554 missense probably benign 0.00
R5734:Zfp382 UTSW 7 30134430 missense probably damaging 1.00
R5796:Zfp382 UTSW 7 30133349 missense probably damaging 1.00
R6062:Zfp382 UTSW 7 30133590 missense probably damaging 1.00
R6300:Zfp382 UTSW 7 30131629 splice site probably null
R6312:Zfp382 UTSW 7 30134538 missense probably damaging 0.99
R6894:Zfp382 UTSW 7 30125836 missense probably benign
R7764:Zfp382 UTSW 7 30133275 missense probably benign 0.04
R7771:Zfp382 UTSW 7 30133335 missense probably damaging 1.00
R7794:Zfp382 UTSW 7 30131610 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- AGTCCTACCTTATCGAGCACG -3'
(R):5'- GGGTAATGAGGTTCGATTTACAGC -3'

Sequencing Primer
(F):5'- GAGAAGCCCTACATTTGCTGTCAG -3'
(R):5'- CCACACTCTTGACATTCATAGGG -3'
Posted On2014-11-12