Incidental Mutation 'R2416:Cryba1'
ID249011
Institutional Source Beutler Lab
Gene Symbol Cryba1
Ensembl Gene ENSMUSG00000000724
Gene Namecrystallin, beta A1
SynonymsCryb, BA3/A1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2416 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location77718615-77725283 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77720900 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 116 (I116F)
Ref Sequence ENSEMBL: ENSMUSP00000077693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078623] [ENSMUST00000181023]
Predicted Effect probably damaging
Transcript: ENSMUST00000078623
AA Change: I116F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077693
Gene: ENSMUSG00000000724
AA Change: I116F

DomainStartEndE-ValueType
XTALbg 32 116 1.27e-43 SMART
XTALbg 125 213 3.49e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124178
Predicted Effect probably benign
Transcript: ENSMUST00000181023
SMART Domains Protein: ENSMUSP00000137922
Gene: ENSMUSG00000037857

DomainStartEndE-ValueType
low complexity region 7 61 N/A INTRINSIC
Pfam:NUFIP2 89 681 7e-293 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Mammalian lens crystallins are divided into alpha, beta, and gamma families. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Beta-crystallins, the most heterogeneous, differ by the presence of the C-terminal extension (present in the basic group, none in the acidic group). Beta-crystallins form aggregates of different sizes and are able to self-associate to form dimers or to form heterodimers with other beta-crystallins. This gene, a beta acidic group member, encodes two proteins (crystallin, beta A3 and crystallin, beta A1) from a single mRNA. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for a knock-out allele exhibit microphthalmia, congenital nuclear cataracts, persistent hyaloid artery, and lens defects including impaired lysosomal cargo clearance, increased calcium level, and cytoskeletal defects. Homozygotes for an ENU allele show microphthalmia and total cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cep152 A T 2: 125,564,172 L1480* probably null Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eif3m G T 2: 105,013,833 P76T probably benign Het
Eya1 A G 1: 14,270,703 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Glyat T A 19: 12,651,254 S138T possibly damaging Het
Gm10093 G T 17: 78,492,516 W312L probably damaging Het
Gpr160 A G 3: 30,896,009 T77A probably benign Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Park7 A G 4: 150,908,401 S3P probably benign Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Zfp382 A G 7: 30,134,403 Y493C probably damaging Het
Other mutations in Cryba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02964:Cryba1 APN 11 77719381 intron probably benign
R0211:Cryba1 UTSW 11 77718867 missense probably damaging 0.99
R0211:Cryba1 UTSW 11 77718867 missense probably damaging 0.99
R0724:Cryba1 UTSW 11 77719457 missense probably damaging 1.00
R2357:Cryba1 UTSW 11 77722601 intron probably benign
R6866:Cryba1 UTSW 11 77719529 missense probably benign 0.05
R7624:Cryba1 UTSW 11 77722717 missense probably damaging 1.00
R7805:Cryba1 UTSW 11 77722608 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAATTGCTCCCTAAATTTCAGGAAG -3'
(R):5'- CTCCCTTAGGCCATATAGGTTTTG -3'

Sequencing Primer
(F):5'- GAGTACACTGTAGTTGTCTTCAGAC -3'
(R):5'- AGGCCATATAGGTTTTGAGTACC -3'
Posted On2014-11-12