Incidental Mutation 'R2416:Atp8a2'
ID 249014
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene Name ATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonyms Ib, wl, agil
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.362) question?
Stock # R2416 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 59884980-60324363 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60162457 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 755 (R755G)
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
AlphaFold P98200
Predicted Effect probably damaging
Transcript: ENSMUST00000080368
AA Change: R755G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: R755G

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,385,791 (GRCm39) D58G probably benign Het
Bard1 G T 1: 71,113,811 (GRCm39) T390N probably benign Het
Birc6 T C 17: 74,915,214 (GRCm39) S1635P possibly damaging Het
Cep152 A T 2: 125,406,092 (GRCm39) L1480* probably null Het
Cryba1 T A 11: 77,611,726 (GRCm39) I116F probably damaging Het
Cttnbp2 A G 6: 18,448,285 (GRCm39) S125P probably damaging Het
Cyp2b13 A G 7: 25,795,246 (GRCm39) *492W probably null Het
Eif3m G T 2: 104,844,178 (GRCm39) P76T probably benign Het
Eya1 A G 1: 14,340,927 (GRCm39) probably null Het
Fam43b G C 4: 138,122,409 (GRCm39) R304G probably benign Het
Fat1 T C 8: 45,479,420 (GRCm39) I2822T probably damaging Het
Glyat T A 19: 12,628,618 (GRCm39) S138T possibly damaging Het
Gpr160 A G 3: 30,950,158 (GRCm39) T77A probably benign Het
Hdac1-ps G T 17: 78,799,945 (GRCm39) W312L probably damaging Het
Krt19 T C 11: 100,036,433 (GRCm39) I85V probably benign Het
Mbtps1 A G 8: 120,265,656 (GRCm39) I297T probably damaging Het
Park7 A G 4: 150,992,858 (GRCm39) S3P probably benign Het
Rtel1 C T 2: 180,982,324 (GRCm39) T358I possibly damaging Het
Slc11a1 T C 1: 74,422,803 (GRCm39) L311P probably damaging Het
Ulk2 C T 11: 61,672,865 (GRCm39) G910R probably damaging Het
Zdhhc14 G A 17: 5,803,283 (GRCm39) R462H probably benign Het
Zfp382 A G 7: 29,833,828 (GRCm39) Y493C probably damaging Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59,928,910 (GRCm39) missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60,265,512 (GRCm39) missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60,282,437 (GRCm39) missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60,253,317 (GRCm39) splice site probably benign
IGL01634:Atp8a2 APN 14 60,235,511 (GRCm39) missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59,928,982 (GRCm39) missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60,260,962 (GRCm39) missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60,263,609 (GRCm39) missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 60,094,497 (GRCm39) missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60,264,369 (GRCm39) splice site probably null
IGL02211:Atp8a2 APN 14 60,265,425 (GRCm39) missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60,254,248 (GRCm39) missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 60,235,451 (GRCm39) missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60,249,907 (GRCm39) splice site probably benign
IGL02795:Atp8a2 APN 14 60,271,191 (GRCm39) missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 60,039,701 (GRCm39) missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 60,162,571 (GRCm39) nonsense probably null
IGL03307:Atp8a2 APN 14 60,253,321 (GRCm39) critical splice donor site probably null
IGL03345:Atp8a2 APN 14 60,011,460 (GRCm39) missense probably benign
PIT4431001:Atp8a2 UTSW 14 59,892,075 (GRCm39) missense probably benign
R0334:Atp8a2 UTSW 14 59,928,961 (GRCm39) missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 60,097,661 (GRCm39) missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 60,011,193 (GRCm39) missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60,260,593 (GRCm39) missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60,247,330 (GRCm39) missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R0908:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R0991:Atp8a2 UTSW 14 60,031,378 (GRCm39) missense probably benign 0.33
R1025:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1190:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1387:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1426:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1442:Atp8a2 UTSW 14 60,097,772 (GRCm39) splice site probably benign
R1472:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1538:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1573:Atp8a2 UTSW 14 60,097,655 (GRCm39) missense probably benign 0.00
R1620:Atp8a2 UTSW 14 60,028,632 (GRCm39) missense probably benign
R1661:Atp8a2 UTSW 14 60,097,635 (GRCm39) missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 60,028,689 (GRCm39) missense probably benign 0.00
R1749:Atp8a2 UTSW 14 60,097,623 (GRCm39) nonsense probably null
R1796:Atp8a2 UTSW 14 60,258,207 (GRCm39) critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60,324,073 (GRCm39) missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60,243,815 (GRCm39) missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1936:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R1937:Atp8a2 UTSW 14 60,097,719 (GRCm39) missense probably benign 0.01
R2760:Atp8a2 UTSW 14 60,097,641 (GRCm39) missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59,928,914 (GRCm39) frame shift probably null
R3621:Atp8a2 UTSW 14 60,263,587 (GRCm39) splice site probably null
R3768:Atp8a2 UTSW 14 60,281,785 (GRCm39) missense probably benign 0.19
R3784:Atp8a2 UTSW 14 60,011,415 (GRCm39) missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60,263,589 (GRCm39) critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60,265,434 (GRCm39) missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59,892,078 (GRCm39) missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59,928,916 (GRCm39) missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60,245,918 (GRCm39) nonsense probably null
R5059:Atp8a2 UTSW 14 59,928,986 (GRCm39) missense probably benign 0.00
R5529:Atp8a2 UTSW 14 60,031,314 (GRCm39) critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60,258,242 (GRCm39) missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60,281,775 (GRCm39) missense probably benign
R6295:Atp8a2 UTSW 14 60,249,848 (GRCm39) nonsense probably null
R6393:Atp8a2 UTSW 14 60,011,204 (GRCm39) nonsense probably null
R6454:Atp8a2 UTSW 14 60,245,948 (GRCm39) splice site probably null
R6651:Atp8a2 UTSW 14 60,011,470 (GRCm39) missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60,245,857 (GRCm39) missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60,284,171 (GRCm39) missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60,249,859 (GRCm39) missense probably benign 0.33
R7032:Atp8a2 UTSW 14 60,255,289 (GRCm39) splice site probably null
R7243:Atp8a2 UTSW 14 59,885,291 (GRCm39) missense probably benign
R7352:Atp8a2 UTSW 14 60,028,653 (GRCm39) missense probably benign
R7355:Atp8a2 UTSW 14 60,282,453 (GRCm39) missense possibly damaging 0.65
R7382:Atp8a2 UTSW 14 59,892,043 (GRCm39) missense probably benign 0.00
R7451:Atp8a2 UTSW 14 60,028,630 (GRCm39) missense probably null 0.00
R7483:Atp8a2 UTSW 14 60,245,824 (GRCm39) missense probably benign 0.00
R7516:Atp8a2 UTSW 14 60,094,516 (GRCm39) missense probably damaging 1.00
R7831:Atp8a2 UTSW 14 60,011,202 (GRCm39) missense probably damaging 0.99
R8116:Atp8a2 UTSW 14 60,263,657 (GRCm39) missense probably damaging 1.00
R8171:Atp8a2 UTSW 14 60,283,493 (GRCm39) missense probably damaging 1.00
R8504:Atp8a2 UTSW 14 59,885,366 (GRCm39) nonsense probably null
R8516:Atp8a2 UTSW 14 59,928,921 (GRCm39) missense probably benign 0.00
R8552:Atp8a2 UTSW 14 60,011,431 (GRCm39) missense probably benign 0.00
R8852:Atp8a2 UTSW 14 60,162,545 (GRCm39) missense probably damaging 1.00
R9367:Atp8a2 UTSW 14 60,249,827 (GRCm39) critical splice donor site probably null
R9469:Atp8a2 UTSW 14 60,028,668 (GRCm39) missense probably benign 0.32
R9691:Atp8a2 UTSW 14 60,245,829 (GRCm39) missense probably damaging 0.96
R9709:Atp8a2 UTSW 14 60,271,187 (GRCm39) missense probably damaging 0.98
Z1088:Atp8a2 UTSW 14 60,265,419 (GRCm39) missense probably benign
Z1177:Atp8a2 UTSW 14 60,243,779 (GRCm39) missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGAGCTACTTCCTGCTTTGAGC -3'
(R):5'- CTGTATGAAGCCCACAAATGTTC -3'

Sequencing Primer
(F):5'- CTTTGAGCAAAAATCTAGGAGACAAC -3'
(R):5'- CTTTTTCAAGGCAACAAGGGC -3'
Posted On 2014-11-12