Incidental Mutation 'R2416:Zdhhc14'
ID249015
Institutional Source Beutler Lab
Gene Symbol Zdhhc14
Ensembl Gene ENSMUSG00000034265
Gene Namezinc finger, DHHC domain containing 14
SynonymsNew1cp, B530001K09Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R2416 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location5492557-5753811 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 5753008 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 462 (R462H)
Ref Sequence ENSEMBL: ENSMUSP00000086589 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089185]
Predicted Effect probably benign
Transcript: ENSMUST00000089185
AA Change: R462H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000086589
Gene: ENSMUSG00000034265
AA Change: R462H

DomainStartEndE-ValueType
transmembrane domain 62 81 N/A INTRINSIC
transmembrane domain 91 110 N/A INTRINSIC
Pfam:zf-DHHC 160 289 1.8e-38 PFAM
low complexity region 351 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cep152 A T 2: 125,564,172 L1480* probably null Het
Cryba1 T A 11: 77,720,900 I116F probably damaging Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eif3m G T 2: 105,013,833 P76T probably benign Het
Eya1 A G 1: 14,270,703 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Glyat T A 19: 12,651,254 S138T possibly damaging Het
Gm10093 G T 17: 78,492,516 W312L probably damaging Het
Gpr160 A G 3: 30,896,009 T77A probably benign Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Park7 A G 4: 150,908,401 S3P probably benign Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zfp382 A G 7: 30,134,403 Y493C probably damaging Het
Other mutations in Zdhhc14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Zdhhc14 APN 17 5752684 splice site probably benign
IGL00909:Zdhhc14 APN 17 5752792 missense probably benign
IGL00964:Zdhhc14 APN 17 5712481 missense probably damaging 1.00
IGL01398:Zdhhc14 APN 17 5712463 missense possibly damaging 0.90
IGL01483:Zdhhc14 APN 17 5712458 missense probably benign 0.01
IGL02185:Zdhhc14 APN 17 5752882 missense probably benign 0.01
IGL02801:Zdhhc14 APN 17 5726819 splice site probably null
R0189:Zdhhc14 UTSW 17 5725264 missense possibly damaging 0.90
R0304:Zdhhc14 UTSW 17 5725336 splice site probably benign
R0648:Zdhhc14 UTSW 17 5493602 missense probably benign 0.01
R1017:Zdhhc14 UTSW 17 5493649 missense probably damaging 0.99
R1595:Zdhhc14 UTSW 17 5493556 missense probably benign 0.00
R3420:Zdhhc14 UTSW 17 5753091 makesense probably null
R3421:Zdhhc14 UTSW 17 5753091 makesense probably null
R4063:Zdhhc14 UTSW 17 5752708 missense probably damaging 1.00
R4088:Zdhhc14 UTSW 17 5726856 missense probably benign 0.01
R5359:Zdhhc14 UTSW 17 5493546 missense probably benign
R6236:Zdhhc14 UTSW 17 5493643 missense probably damaging 1.00
R7029:Zdhhc14 UTSW 17 5647911 missense probably damaging 0.97
R7350:Zdhhc14 UTSW 17 5726876 missense probably benign 0.44
R7873:Zdhhc14 UTSW 17 5712454 missense probably benign 0.37
R7956:Zdhhc14 UTSW 17 5712454 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- CTGCATATGCCTGGGAAACC -3'
(R):5'- GGTCCACTCTGCAGATTCCAAAC -3'

Sequencing Primer
(F):5'- ACCCCATGTGCTAGCCTGAC -3'
(R):5'- ACAAAACGTCCTCTTGGCTATG -3'
Posted On2014-11-12