Incidental Mutation 'R2416:Gm10093'
ID249018
Institutional Source Beutler Lab
Gene Symbol Gm10093
Ensembl Gene ENSMUSG00000061062
Gene Namepredicted pseudogene 10093
SynonymsEG15181
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.912) question?
Stock #R2416 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location78491565-78493541 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78492516 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 312 (W312L)
Ref Sequence ENSEMBL: ENSMUSP00000078339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079363]
Predicted Effect probably damaging
Transcript: ENSMUST00000079363
AA Change: W312L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078339
Gene: ENSMUSG00000061062
AA Change: W312L

DomainStartEndE-ValueType
Pfam:Hist_deacetyl 18 320 3.2e-84 PFAM
low complexity region 390 402 N/A INTRINSIC
low complexity region 417 430 N/A INTRINSIC
low complexity region 443 471 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cep152 A T 2: 125,564,172 L1480* probably null Het
Cryba1 T A 11: 77,720,900 I116F probably damaging Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eif3m G T 2: 105,013,833 P76T probably benign Het
Eya1 A G 1: 14,270,703 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Glyat T A 19: 12,651,254 S138T possibly damaging Het
Gpr160 A G 3: 30,896,009 T77A probably benign Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Park7 A G 4: 150,908,401 S3P probably benign Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Zfp382 A G 7: 30,134,403 Y493C probably damaging Het
Other mutations in Gm10093
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Gm10093 APN 17 78492129 missense probably damaging 1.00
IGL01983:Gm10093 APN 17 78492853 missense probably benign
IGL02543:Gm10093 APN 17 78491874 missense probably damaging 0.97
R1174:Gm10093 UTSW 17 78492078 missense probably benign 0.01
R1605:Gm10093 UTSW 17 78492108 missense probably damaging 0.98
R2919:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R2920:Gm10093 UTSW 17 78492846 missense probably damaging 0.98
R3846:Gm10093 UTSW 17 78492972 missense possibly damaging 0.91
R4544:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R4546:Gm10093 UTSW 17 78492959 missense probably benign 0.02
R5223:Gm10093 UTSW 17 78492438 missense probably benign 0.02
R5297:Gm10093 UTSW 17 78492758 missense probably benign
R6164:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
R6568:Gm10093 UTSW 17 78492588 missense probably damaging 1.00
R6726:Gm10093 UTSW 17 78492858 missense probably damaging 0.99
R6901:Gm10093 UTSW 17 78492660 missense probably benign 0.07
R6923:Gm10093 UTSW 17 78492914 missense possibly damaging 0.91
R7838:Gm10093 UTSW 17 78492018 missense probably damaging 1.00
R7921:Gm10093 UTSW 17 78492018 missense probably damaging 1.00
R8002:Gm10093 UTSW 17 78492287 missense probably damaging 0.99
X0060:Gm10093 UTSW 17 78492128 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCACCTTTAAGCCAGTCATG -3'
(R):5'- CCTCAAGTTCTCAAAGAGACGC -3'

Sequencing Primer
(F):5'- AGATGTTCCAGCCTAGTGCAG -3'
(R):5'- TCTCAAAGAGACGCTGCTTG -3'
Posted On2014-11-12