Incidental Mutation 'R2416:Glyat'
ID249019
Institutional Source Beutler Lab
Gene Symbol Glyat
Ensembl Gene ENSMUSG00000063683
Gene Nameglycine-N-acyltransferase
SynonymsA330009E03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2416 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location12633308-12653911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 12651254 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 138 (S138T)
Ref Sequence ENSEMBL: ENSMUSP00000114002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044976] [ENSMUST00000119960]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044976
AA Change: S172T

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043308
Gene: ENSMUSG00000063683
AA Change: S172T

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 206 1.9e-90 PFAM
Pfam:Gly_acyl_tr_C 207 295 2.8e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119960
AA Change: S138T

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114002
Gene: ENSMUSG00000063683
AA Change: S138T

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 172 1.2e-91 PFAM
Pfam:Gly_acyl_tr_C 173 261 3.6e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123173
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157069
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glycine-N-acyltransferase protein conjugates glycine with acyl-CoA substrates in the mitochondria. The protein is thought to be important in the detoxification of endogenous and xenobiotic acyl-CoA's. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,663,834 D58G probably benign Het
Atp8a2 T C 14: 59,925,008 R755G probably damaging Het
Bard1 G T 1: 71,074,652 T390N probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Cep152 A T 2: 125,564,172 L1480* probably null Het
Cryba1 T A 11: 77,720,900 I116F probably damaging Het
Cttnbp2 A G 6: 18,448,286 S125P probably damaging Het
Cyp2b13 A G 7: 26,095,821 *492W probably null Het
Eif3m G T 2: 105,013,833 P76T probably benign Het
Eya1 A G 1: 14,270,703 probably null Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Fat1 T C 8: 45,026,383 I2822T probably damaging Het
Gm10093 G T 17: 78,492,516 W312L probably damaging Het
Gpr160 A G 3: 30,896,009 T77A probably benign Het
Krt19 T C 11: 100,145,607 I85V probably benign Het
Mbtps1 A G 8: 119,538,917 I297T probably damaging Het
Park7 A G 4: 150,908,401 S3P probably benign Het
Rtel1 C T 2: 181,340,531 T358I possibly damaging Het
Slc11a1 T C 1: 74,383,644 L311P probably damaging Het
Ulk2 C T 11: 61,782,039 G910R probably damaging Het
Zdhhc14 G A 17: 5,753,008 R462H probably benign Het
Zfp382 A G 7: 30,134,403 Y493C probably damaging Het
Other mutations in Glyat
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00478:Glyat APN 19 12648133 splice site probably benign
IGL00766:Glyat APN 19 12651262 missense probably benign 0.19
IGL01288:Glyat APN 19 12650355 missense possibly damaging 0.56
IGL02296:Glyat APN 19 12651261 missense probably damaging 0.99
PIT4458001:Glyat UTSW 19 12648009 missense probably benign 0.34
R0416:Glyat UTSW 19 12651453 missense possibly damaging 0.87
R1463:Glyat UTSW 19 12648103 missense probably damaging 1.00
R1750:Glyat UTSW 19 12646315 missense probably benign 0.01
R2504:Glyat UTSW 19 12651398 missense possibly damaging 0.82
R2960:Glyat UTSW 19 12639850 missense probably damaging 1.00
R3958:Glyat UTSW 19 12639833 missense probably benign 0.05
R4126:Glyat UTSW 19 12651479 missense probably benign 0.03
R4561:Glyat UTSW 19 12651280 missense possibly damaging 0.88
R4705:Glyat UTSW 19 12651297 missense possibly damaging 0.68
R5062:Glyat UTSW 19 12650263 missense probably damaging 1.00
R5490:Glyat UTSW 19 12650281 missense probably benign 0.35
R7028:Glyat UTSW 19 12650359 missense probably benign 0.00
R7044:Glyat UTSW 19 12650265 missense probably benign 0.05
R7599:Glyat UTSW 19 12639808 missense probably damaging 0.99
Z1088:Glyat UTSW 19 12648009 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACAACACTGGCCTTTCTGTC -3'
(R):5'- TCTGGTCTTGTGAATGGACAAC -3'

Sequencing Primer
(F):5'- GTCCCTCTAGCATAAGCCTATC -3'
(R):5'- AAGACCTTGGAGCCGGTACTC -3'
Posted On2014-11-12