Mutagenetix > Incidental Mutation

Incidental Mutation 'R2417:Cfap65'

249020

Institutional Source

Beutler Lab

Gene Symbol

Cfap65

Ensembl Gene

ENSMUSG00000047021

Gene Name

cilia and flagella associated protein 65

Synonyms

Ccdc108, B230363K08Rik

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.676) question?

Stock #

R2417 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

74902071-74935599 bp(-) (GRCm38)

Type of Mutation

small insertion (1 aa in frame mutation)

DNA Base Change (assembly)

GTCTT to GTCTTCTT at 74927186 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000092440 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094844]

AlphaFold

Q3V0B4

Predicted Effect

probably benign
Transcript: ENSMUST00000094844

SMART Domains

Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021

Domain	Start	End	E-Value	Type
transmembrane domain	111	133	N/A	INTRINSIC
low complexity region	212	223	N/A	INTRINSIC
internal_repeat_1	745	890	9.31e-5	PROSPERO
internal_repeat_1	1167	1322	9.31e-5	PROSPERO
low complexity region	1350	1361	N/A	INTRINSIC
low complexity region	1574	1592	N/A	INTRINSIC
coiled coil region	1687	1724	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130489

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139950

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130008F23Rik	T	A	17: 40,880,210 (GRCm38)	K109N	probably benign	Het
Adcy3	T	C	12: 4,208,627 (GRCm38)	V848A	probably benign	Het
Ahnak2	G	A	12: 112,775,371 (GRCm38)	P756S	probably damaging	Het
Alpk3	C	A	7: 81,092,753 (GRCm38)	P773T	probably benign	Het
Arhgef38	T	C	3: 133,146,473 (GRCm38)	K319E	probably damaging	Het
Bbs7	C	T	3: 36,592,397 (GRCm38)	A425T	probably damaging	Het
Cacna1e	T	A	1: 154,472,193 (GRCm38)	R879W	probably damaging	Het
Cpsf7	T	C	19: 10,525,968 (GRCm38)		probably benign	Het
Ctf2	A	G	7: 127,719,587 (GRCm38)	V80A	probably benign	Het
Ddhd1	A	G	14: 45,657,272 (GRCm38)	L30P	probably damaging	Het
Eml1	A	G	12: 108,536,275 (GRCm38)	D700G	probably benign	Het
Epha7	C	T	4: 28,947,579 (GRCm38)	P613L	probably damaging	Het
Fam43b	G	C	4: 138,395,098 (GRCm38)	R304G	probably benign	Het
Itih3	G	A	14: 30,917,664 (GRCm38)	T400I	probably benign	Het
Lrrc14	T	A	15: 76,713,421 (GRCm38)	L117Q	probably damaging	Het
Ncbp1	C	T	4: 46,168,530 (GRCm38)	S626L	probably benign	Het
Nefh	C	T	11: 4,939,479 (GRCm38)	D1047N	unknown	Het
Ptprm	T	G	17: 66,944,326 (GRCm38)	T519P	probably damaging	Het
Sorl1	T	G	9: 41,980,711 (GRCm38)	D1881A	probably damaging	Het
Sox12	T	C	2: 152,396,797 (GRCm38)	D301G	possibly damaging	Het
Vmn2r14	C	T	5: 109,224,463 (GRCm38)	E54K	probably benign	Het
Vmn2r26	A	G	6: 124,061,350 (GRCm38)	N628S	probably damaging	Het
Zfp143	G	A	7: 110,069,596 (GRCm38)	V36M	possibly damaging	Het
Zfp850	A	T	7: 27,989,183 (GRCm38)	N533K	possibly damaging	Het

Other mutations in Cfap65

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01107:Cfap65	APN	1	74,919,183 (GRCm38)	critical splice donor site	probably null
IGL01526:Cfap65	APN	1	74,911,078 (GRCm38)	missense	probably damaging	1.00
IGL01716:Cfap65	APN	1	74,927,194 (GRCm38)	missense	probably benign
IGL01780:Cfap65	APN	1	74,928,348 (GRCm38)	nonsense	probably null
IGL01993:Cfap65	APN	1	74,920,543 (GRCm38)	missense	probably damaging	1.00
IGL02164:Cfap65	APN	1	74,928,145 (GRCm38)	missense	possibly damaging	0.87
IGL02350:Cfap65	APN	1	74,928,348 (GRCm38)	nonsense	probably null
IGL02357:Cfap65	APN	1	74,928,348 (GRCm38)	nonsense	probably null
IGL02576:Cfap65	APN	1	74,903,458 (GRCm38)	missense	probably damaging	1.00
IGL02756:Cfap65	APN	1	74,905,080 (GRCm38)	missense	probably benign	0.00
IGL02792:Cfap65	APN	1	74,927,178 (GRCm38)	missense	probably damaging	1.00
IGL02874:Cfap65	APN	1	74,911,108 (GRCm38)	nonsense	probably null
IGL03101:Cfap65	APN	1	74,928,433 (GRCm38)	missense	possibly damaging	0.61
IGL03348:Cfap65	APN	1	74,927,619 (GRCm38)	missense	probably damaging	1.00
IGL03396:Cfap65	APN	1	74,904,642 (GRCm38)	missense	probably damaging	1.00
PIT4131001:Cfap65	UTSW	1	74,928,342 (GRCm38)	missense	probably benign	0.05
R0077:Cfap65	UTSW	1	74,931,918 (GRCm38)	missense	probably damaging	1.00
R0227:Cfap65	UTSW	1	74,931,958 (GRCm38)	nonsense	probably null
R0281:Cfap65	UTSW	1	74,927,071 (GRCm38)	missense	probably damaging	1.00
R0312:Cfap65	UTSW	1	74,904,067 (GRCm38)	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74,929,302 (GRCm38)	missense	probably damaging	1.00
R0331:Cfap65	UTSW	1	74,929,301 (GRCm38)	missense	probably damaging	1.00
R0347:Cfap65	UTSW	1	74,926,444 (GRCm38)	missense	probably damaging	1.00
R0359:Cfap65	UTSW	1	74,920,601 (GRCm38)	missense	probably benign	0.00
R0361:Cfap65	UTSW	1	74,925,440 (GRCm38)	missense	probably damaging	1.00
R0465:Cfap65	UTSW	1	74,916,884 (GRCm38)	missense	possibly damaging	0.92
R0549:Cfap65	UTSW	1	74,918,444 (GRCm38)	missense	probably benign	0.01
R0646:Cfap65	UTSW	1	74,902,169 (GRCm38)	missense	probably benign	0.09
R0734:Cfap65	UTSW	1	74,918,887 (GRCm38)	missense	probably damaging	1.00
R0763:Cfap65	UTSW	1	74,904,682 (GRCm38)	missense	probably damaging	0.99
R0990:Cfap65	UTSW	1	74,921,519 (GRCm38)	missense	possibly damaging	0.60
R1079:Cfap65	UTSW	1	74,905,713 (GRCm38)	missense	probably damaging	0.99
R1079:Cfap65	UTSW	1	74,902,447 (GRCm38)	missense	probably damaging	0.98
R1083:Cfap65	UTSW	1	74,918,504 (GRCm38)	splice site	probably benign
R1159:Cfap65	UTSW	1	74,929,340 (GRCm38)	missense	probably damaging	1.00
R1282:Cfap65	UTSW	1	74,925,104 (GRCm38)	missense	probably benign	0.03
R1644:Cfap65	UTSW	1	74,917,175 (GRCm38)	missense	probably damaging	1.00
R1796:Cfap65	UTSW	1	74,918,948 (GRCm38)	missense	probably damaging	1.00
R1950:Cfap65	UTSW	1	74,907,660 (GRCm38)	missense	probably damaging	1.00
R2079:Cfap65	UTSW	1	74,917,199 (GRCm38)	missense	probably benign	0.30
R2132:Cfap65	UTSW	1	74,907,691 (GRCm38)	missense	probably damaging	1.00
R2136:Cfap65	UTSW	1	74,917,273 (GRCm38)	frame shift	probably null
R2219:Cfap65	UTSW	1	74,904,025 (GRCm38)	missense	probably damaging	1.00
R2220:Cfap65	UTSW	1	74,904,025 (GRCm38)	missense	probably damaging	1.00
R2291:Cfap65	UTSW	1	74,926,475 (GRCm38)	missense	probably damaging	1.00
R3114:Cfap65	UTSW	1	74,927,132 (GRCm38)	missense	probably damaging	1.00
R4202:Cfap65	UTSW	1	74,920,542 (GRCm38)	missense	probably damaging	1.00
R4214:Cfap65	UTSW	1	74,927,681 (GRCm38)	missense	possibly damaging	0.93
R4254:Cfap65	UTSW	1	74,903,358 (GRCm38)	missense	probably benign	0.17
R4547:Cfap65	UTSW	1	74,907,612 (GRCm38)	missense	probably damaging	1.00
R4548:Cfap65	UTSW	1	74,907,612 (GRCm38)	missense	probably damaging	1.00
R4588:Cfap65	UTSW	1	74,904,056 (GRCm38)	missense	possibly damaging	0.92
R4657:Cfap65	UTSW	1	74,925,354 (GRCm38)	intron	probably benign
R4701:Cfap65	UTSW	1	74,918,908 (GRCm38)	missense	probably damaging	0.96
R4755:Cfap65	UTSW	1	74,928,361 (GRCm38)	missense	probably damaging	1.00
R4820:Cfap65	UTSW	1	74,927,632 (GRCm38)	missense	probably benign	0.06
R4831:Cfap65	UTSW	1	74,917,295 (GRCm38)	missense	possibly damaging	0.93
R4866:Cfap65	UTSW	1	74,925,557 (GRCm38)	missense	probably damaging	1.00
R4869:Cfap65	UTSW	1	74,919,261 (GRCm38)	missense	probably benign	0.00
R4881:Cfap65	UTSW	1	74,907,613 (GRCm38)	missense	probably damaging	1.00
R4884:Cfap65	UTSW	1	74,903,124 (GRCm38)	missense	possibly damaging	0.47
R4950:Cfap65	UTSW	1	74,906,336 (GRCm38)	nonsense	probably null
R5074:Cfap65	UTSW	1	74,922,978 (GRCm38)	missense	probably benign	0.04
R5083:Cfap65	UTSW	1	74,906,441 (GRCm38)	missense	probably damaging	1.00
R5164:Cfap65	UTSW	1	74,926,516 (GRCm38)	missense	probably damaging	1.00
R5268:Cfap65	UTSW	1	74,924,902 (GRCm38)	missense	probably benign	0.07
R5333:Cfap65	UTSW	1	74,903,175 (GRCm38)	missense	probably benign	0.03
R5417:Cfap65	UTSW	1	74,925,100 (GRCm38)	missense	probably damaging	1.00
R5582:Cfap65	UTSW	1	74,907,518 (GRCm38)	intron	probably benign
R5669:Cfap65	UTSW	1	74,924,968 (GRCm38)	missense	probably damaging	0.99
R6010:Cfap65	UTSW	1	74,923,031 (GRCm38)	missense	probably damaging	1.00
R6084:Cfap65	UTSW	1	74,920,405 (GRCm38)	missense	probably damaging	1.00
R6112:Cfap65	UTSW	1	74,903,139 (GRCm38)	missense	probably benign	0.14
R6425:Cfap65	UTSW	1	74,927,709 (GRCm38)	missense	probably benign	0.00
R6677:Cfap65	UTSW	1	74,904,685 (GRCm38)	missense	probably damaging	1.00
R6693:Cfap65	UTSW	1	74,917,286 (GRCm38)	missense	probably benign	0.00
R6838:Cfap65	UTSW	1	74,932,021 (GRCm38)	missense	probably benign	0.06
R6861:Cfap65	UTSW	1	74,925,115 (GRCm38)	missense	probably damaging	1.00
R6958:Cfap65	UTSW	1	74,931,899 (GRCm38)	missense	possibly damaging	0.58
R7134:Cfap65	UTSW	1	74,926,633 (GRCm38)	missense	probably benign	0.01
R7320:Cfap65	UTSW	1	74,926,604 (GRCm38)	missense	probably damaging	0.99
R7340:Cfap65	UTSW	1	74,921,583 (GRCm38)	missense	probably benign	0.07
R7426:Cfap65	UTSW	1	74,920,426 (GRCm38)	missense	possibly damaging	0.92
R7529:Cfap65	UTSW	1	74,926,610 (GRCm38)	missense	probably damaging	1.00
R7634:Cfap65	UTSW	1	74,902,434 (GRCm38)	missense	probably damaging	1.00
R7654:Cfap65	UTSW	1	74,933,144 (GRCm38)	missense	probably benign	0.44
R7704:Cfap65	UTSW	1	74,928,368 (GRCm38)	missense	probably benign	0.19
R7727:Cfap65	UTSW	1	74,926,625 (GRCm38)	missense	probably benign	0.00
R7895:Cfap65	UTSW	1	74,933,162 (GRCm38)	missense	probably benign	0.05
R8215:Cfap65	UTSW	1	74,910,743 (GRCm38)	missense	probably damaging	1.00
R8344:Cfap65	UTSW	1	74,928,044 (GRCm38)	missense	probably benign	0.01
R8345:Cfap65	UTSW	1	74,928,044 (GRCm38)	missense	probably benign	0.01
R8413:Cfap65	UTSW	1	74,917,169 (GRCm38)	nonsense	probably null
R8431:Cfap65	UTSW	1	74,928,044 (GRCm38)	missense	probably benign	0.01
R8432:Cfap65	UTSW	1	74,928,044 (GRCm38)	missense	probably benign	0.01
R8528:Cfap65	UTSW	1	74,905,937 (GRCm38)	missense	possibly damaging	0.88
R8809:Cfap65	UTSW	1	74,903,223 (GRCm38)	missense	probably benign	0.43
R8996:Cfap65	UTSW	1	74,902,188 (GRCm38)	missense	probably benign	0.11
R9020:Cfap65	UTSW	1	74,920,393 (GRCm38)	missense	probably damaging	1.00
R9043:Cfap65	UTSW	1	74,904,688 (GRCm38)	missense	possibly damaging	0.88
R9127:Cfap65	UTSW	1	74,919,351 (GRCm38)	splice site	probably benign
R9187:Cfap65	UTSW	1	74,917,358 (GRCm38)	missense	probably benign	0.00
R9210:Cfap65	UTSW	1	74,920,408 (GRCm38)	missense	probably benign
R9212:Cfap65	UTSW	1	74,920,408 (GRCm38)	missense	probably benign
R9273:Cfap65	UTSW	1	74,921,610 (GRCm38)	missense	probably benign	0.00
R9454:Cfap65	UTSW	1	74,905,051 (GRCm38)	missense	probably damaging	1.00
R9514:Cfap65	UTSW	1	74,906,309 (GRCm38)	critical splice donor site	probably null
R9595:Cfap65	UTSW	1	74,907,378 (GRCm38)	missense	probably damaging	1.00
R9721:Cfap65	UTSW	1	74,919,342 (GRCm38)	missense	probably benign	0.16
R9742:Cfap65	UTSW	1	74,904,681 (GRCm38)	missense	probably benign	0.08
RF009:Cfap65	UTSW	1	74,905,647 (GRCm38)	missense	probably damaging	1.00
Z1176:Cfap65	UTSW	1	74,910,747 (GRCm38)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGGACGACCATTACCTCTACAG -3'
(R):5'- AGTAAAAGATGTCCGCCCCG -3'

Sequencing Primer
(F):5'- GGACGACCATTACCTCTACAGAAACC -3'
(R):5'- CTCTGGGCAGCCTTGAGATG -3'

Posted On

2014-11-12