Incidental Mutation 'R2417:Arhgef38'
ID249025
Institutional Source Beutler Lab
Gene Symbol Arhgef38
Ensembl Gene ENSMUSG00000040969
Gene NameRho guanine nucleotide exchange factor (GEF) 38
SynonymsD630013G24Rik, 9130221D24Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2417 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location133112278-133234949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 133146473 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 319 (K319E)
Ref Sequence ENSEMBL: ENSMUSP00000114238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000147041]
Predicted Effect probably damaging
Transcript: ENSMUST00000147041
AA Change: K319E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114238
Gene: ENSMUSG00000040969
AA Change: K319E

DomainStartEndE-ValueType
low complexity region 34 49 N/A INTRINSIC
RhoGEF 98 284 2.72e-33 SMART
low complexity region 296 312 N/A INTRINSIC
BAR 315 514 4.8e-29 SMART
SH3 584 643 5.56e-1 SMART
low complexity region 678 689 N/A INTRINSIC
SH3 709 768 1.95e-10 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130008F23Rik T A 17: 40,880,210 K109N probably benign Het
Adcy3 T C 12: 4,208,627 V848A probably benign Het
Ahnak2 G A 12: 112,775,371 P756S probably damaging Het
Alpk3 C A 7: 81,092,753 P773T probably benign Het
Bbs7 C T 3: 36,592,397 A425T probably damaging Het
Cacna1e T A 1: 154,472,193 R879W probably damaging Het
Cfap65 GTCTT GTCTTCTT 1: 74,927,186 probably benign Het
Cpsf7 T C 19: 10,525,968 probably benign Het
Ctf2 A G 7: 127,719,587 V80A probably benign Het
Ddhd1 A G 14: 45,657,272 L30P probably damaging Het
Eml1 A G 12: 108,536,275 D700G probably benign Het
Epha7 C T 4: 28,947,579 P613L probably damaging Het
Fam43b G C 4: 138,395,098 R304G probably benign Het
Itih3 G A 14: 30,917,664 T400I probably benign Het
Lrrc14 T A 15: 76,713,421 L117Q probably damaging Het
Ncbp1 C T 4: 46,168,530 S626L probably benign Het
Nefh C T 11: 4,939,479 D1047N unknown Het
Ptprm T G 17: 66,944,326 T519P probably damaging Het
Sorl1 T G 9: 41,980,711 D1881A probably damaging Het
Sox12 T C 2: 152,396,797 D301G possibly damaging Het
Vmn2r14 C T 5: 109,224,463 E54K probably benign Het
Vmn2r26 A G 6: 124,061,350 N628S probably damaging Het
Zfp143 G A 7: 110,069,596 V36M possibly damaging Het
Zfp850 A T 7: 27,989,183 N533K possibly damaging Het
Other mutations in Arhgef38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Arhgef38 APN 3 133132051 missense probably benign 0.05
IGL00533:Arhgef38 APN 3 133116459 nonsense probably null
IGL03031:Arhgef38 APN 3 133132067 missense possibly damaging 0.90
F5770:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
PIT4362001:Arhgef38 UTSW 3 133160830 missense
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0050:Arhgef38 UTSW 3 133132196 missense probably damaging 0.99
R0076:Arhgef38 UTSW 3 133160746 missense possibly damaging 0.52
R0515:Arhgef38 UTSW 3 133149540 missense probably damaging 1.00
R0730:Arhgef38 UTSW 3 133137471 missense probably benign 0.25
R0765:Arhgef38 UTSW 3 133116583 missense probably damaging 1.00
R1054:Arhgef38 UTSW 3 133116465 missense probably damaging 1.00
R1261:Arhgef38 UTSW 3 133160863 missense possibly damaging 0.52
R1568:Arhgef38 UTSW 3 133132464 missense probably damaging 0.98
R1580:Arhgef38 UTSW 3 133133704 missense probably benign 0.24
R1716:Arhgef38 UTSW 3 133140837 missense probably benign 0.35
R1875:Arhgef38 UTSW 3 133133740 critical splice acceptor site probably null
R2118:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2119:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R2122:Arhgef38 UTSW 3 133160753 missense probably benign 0.31
R3832:Arhgef38 UTSW 3 133206925 missense possibly damaging 0.89
R4657:Arhgef38 UTSW 3 133234681 missense probably damaging 1.00
R4666:Arhgef38 UTSW 3 133140772 critical splice donor site probably null
R4732:Arhgef38 UTSW 3 133132269 nonsense probably null
R4733:Arhgef38 UTSW 3 133132269 nonsense probably null
R5059:Arhgef38 UTSW 3 133137414 missense probably damaging 1.00
R5108:Arhgef38 UTSW 3 133137268 missense probably benign 0.14
R5310:Arhgef38 UTSW 3 133116466 missense probably damaging 0.98
R5820:Arhgef38 UTSW 3 133160799 missense probably benign 0.44
R5987:Arhgef38 UTSW 3 133206958 missense possibly damaging 0.67
R6115:Arhgef38 UTSW 3 133132613 intron probably null
R6313:Arhgef38 UTSW 3 133234708 missense possibly damaging 0.80
R6339:Arhgef38 UTSW 3 133133662 missense probably benign 0.35
R6356:Arhgef38 UTSW 3 133140877 missense probably benign 0.01
R6648:Arhgef38 UTSW 3 133132475 missense probably damaging 1.00
R7050:Arhgef38 UTSW 3 133133627 start gained probably benign
R7083:Arhgef38 UTSW 3 133132436 missense unknown
R7561:Arhgef38 UTSW 3 133160728 missense
R7769:Arhgef38 UTSW 3 133149622 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGGCACTCACTTTGTTTCG -3'
(R):5'- TCCCTGAGGAAGAGAGTTAAAATCC -3'

Sequencing Primer
(F):5'- CGTGTTCTAGATCGATTCACGG -3'
(R):5'- GTTCTGTCCTCAGTAGAAACATTGG -3'
Posted On2014-11-12